add unit test for ihfold v3 parse #107
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
--- | |
name: Smoke Tests | |
on: [push] | |
jobs: | |
test: | |
name: Smoke tests | |
runs-on: ubuntu-20.04 | |
steps: | |
- name: Checkout | |
uses: actions/checkout@v2 | |
- name: Setup Python | |
uses: actions/setup-python@v2 | |
with: | |
python-version: 3.8 | |
- name: Build package | |
run: make deps && make | |
- name: python | |
run: ./.venv/bin/python ./scripts/00-example.py | |
- name: rna_analysis | |
run: ./.venv/bin/rna_analysis --sequence AUCCUUUUCAGUUGGGCCUUCUGGUGAUGUUUCUGGCCACCCAGGAGGUCCUGAGGAAGAGGUGGACGGCCAGAUUGACU | |
- name: rna_benchmark | |
run: ./.venv/bin/rna_benchmark --cases cases/cases.yaml --verbose | |
- name: rna_energy | |
run: | | |
./.venv/bin/rna_energy --sequence ACGUGAAGGCUACGAUAGUGCCAG --dot-bracket '.((((..[[[)))).....]]]..' | |
./.venv/bin/rna_energy --sequence ACGUGAAGGCUACGAUAGUGCCAG --dot-bracket '.((((..[[[)))).....]]]..' --energy pkenergy | |
./.venv/bin/rna_energy --sequence ACGUGAAGGCUACGAUAGUGCCAG --dot-bracket '.((((..[[[)))).....]]]..' --energy vienna |