primer_design TypeError: SeqRecord.__init__() got multiple values for argument 'id'

[AlexeyNesterovichEst]

Hi!

I get the issue with primer_design and I use your example:

from pydna.dseqrecord import Dseqrecord
# Let's create a DNA sequence record, and add a feature to it
dsr = Dseqrecord("ATGCAAACAGTAATGATGGATGACATTCAAAGCACTGATTCTATTGCTGAAAAAGATAAT")
dsr.add_feature(x=0, y=60,type="gene", label="my_gene") # We add a feature to highlight the sequence as a gene
dsr.figure()

# Now let's design primers to amplify it
from pydna.design import primer_design
# limit is the minimum length of the primer, target_tm is the desired melting temperature of the primer
amplicon = primer_design(dsr, limit=13, target_tm=55)
# Let's print the primers, and a figure that shows where they align with the template sequence
print("forward primer:", amplicon.forward_primer.seq)
print("reverse primer:", amplicon.reverse_primer.seq)
amplicon.figure()

I used your code previously some time ago and it worked.

[manulera]

Hi @AlexeyNesterovichEst, thanks very much for reporting the error. I will create an issue about it.

This seems to be a problem with biopython version 1.85.

You can get the normal behaviour with biopython 1.84. If you are using pip:

pip install pydna
pip install biopython==1.84

I will dig into the biopython issue now.

[manulera]

Should work installing from pip now even if you don't specify biopython 1.84