Report shows wrong taxonomic classification stats for QIIME with UNITE

[d4straub]

Description of the bug

When using UNITE fungi with QIIME2 for taxonomic classification, the statistics in the summary report (results/summary_report/summary_report.html) shows for rank "Kingdom" 100% classification, while all other ranks receive 0%.

This is because UNITE database contains strings such as

k__Fungi;p__Ascomycota;c__Eurotiomycetes;o__Eurotiales;f__Aspergillaceae;g__Aspergillus;s__Aspergillus_penicillioides
k__Fungi
k__Fungi;p__Ascomycota

while Greengenes 16S - Version 13_8 produces taxonomic strings such as

k__Bacteria; p__Proteobacteria; c__Betaproteobacteria
k__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Gallionellales; f__Gallionellaceae
k__Bacteria; p__Bacteroidetes; c__Flavobacteriia; o__Flavobacteriales; f__Flavobacteriaceae; g__Flavobacterium; s__
k__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Comamonadaceae; g__Rhodoferax; s__

and parsing for the report takes only the Greengenes format into account with

ampliseq/assets/report_template.Rmd

Lines 991 to 999 in 4e48b71

	# Remove greengenes85 ".__" placeholders
	df = as.data.frame(lapply(asv_tax, function(x) gsub(".__", "", x)))
	# remove all last, empty ;
	df = as.data.frame(lapply(df, function(x) gsub(" ;","",x)))
	# remove last remaining, empty ;
	df = as.data.frame(lapply(df, function(x) gsub("; $","",x)))
	# get maximum amount of taxa levels per ASV
	max_taxa <- lengths(regmatches(df$Taxon, gregexpr("; ", df$Taxon)))+1

Other taxonomic classifications that I did, i.e. DADA2 with UNITE-Fungi, Kraken2, and SINTAX with UNITE-Fungi (see below), were fine.

Command used and terminal output

nextflow run nf-core/ampliseq -r 2.7.0 -profile cfc --FW_primer CTTGGTCATTTAGAGGAAGTAA --RV_primer GCTGCGTTCTTCATCGATGC --input_fasta "ASV_seqs.fasta" --min_len_asv 1 --dada_ref_taxonomy "unite-fungi=9.0" --sintax_ref_taxonomy "unite-fungi=9.0" --kraken2_ref_tax_custom "https://genome-idx.s3.amazonaws.com/kraken/k2_pluspf_20231009.tar.gz" --kraken2_assign_taxlevels "D,P,C,O,F,G,S" --qiime_ref_taxonomy "unite-fungi" --outdir reclassification

Relevant files

No response

System information

No response

[d4straub]

Doesnt really fit in here, but the stats of the length filter also seems off:
I used --min_len_asv 1 (as above, just to get the distribution figure in the report) and the report says

Filtering omitted all ASVs with length lower than 1 bp.

The number of ASVs was reduced by 27.5 ( 1.51 %), from 1817.5 to 1790 ASVs.

which isnt right, because there were 1790 ASVs already in the input file and no ASV was removed.
The figure itself seems to be fine.

[d4straub]

Documentation issues:

• https://nf-co.re/ampliseq/2.7.0/parameters#multiple_sequencing_runs & https://nf-co.re/ampliseq/2.7.0/parameters#extension should reference --input_folder instead of --input in the help text. Also, that should be more clear in the description.
• https://nf-co.re/ampliseq/2.7.0/parameters#asv-filtering should be before https://nf-co.re/ampliseq/2.7.0/parameters#taxonomic-database (--exclude_taxa is after taxonomic classification, 3 bottom ones are technically all in downstream analysis because in QIIME2)

[d4straub]

This is in dev now, closing the issue.