diff --git a/.github/workflows/R-CMD-check.yaml b/.github/workflows/R-CMD-check.yaml
index 78690fa1..a860475a 100644
--- a/.github/workflows/R-CMD-check.yaml
+++ b/.github/workflows/R-CMD-check.yaml
@@ -47,6 +47,6 @@ jobs:
         with:
           upload-snapshots: true
           #Character vector of arguments to pass to ⁠R CMD check⁠. 
-          args: 'c("--as-cran", "--no-tests", "--no-vignettes", "--no-manual", "--no-build-vignettes", "--ignore-vignettes")'
+          args: 'c("--as-cran", "--no-tests", "--no-vignettes", "--no-manual", "--no-build-vignettes", "--ignore-vignettes", "--no-examples")'
           #Character vector of arguments to pass to ⁠R CMD build.
           build_args: 'c("--no-build-vignettes", "--no-manual")'
diff --git a/.github/workflows/test-coverage.yaml b/.github/workflows/test-coverage.yaml
index 932412b7..d63a8441 100644
--- a/.github/workflows/test-coverage.yaml
+++ b/.github/workflows/test-coverage.yaml
@@ -43,6 +43,7 @@ jobs:
           git clone https://github.com/torognes/swarm.git \
           && cd swarm/ \
           && make
+          sudo cp ../swarm /usr/bin/swarm
 
       - name: Install cutadapt
         run: |
diff --git a/DESCRIPTION b/DESCRIPTION
index a3762c36..7a6274c8 100644
--- a/DESCRIPTION
+++ b/DESCRIPTION
@@ -1,7 +1,7 @@
 Package: MiscMetabar
 Type: Package
 Title: Miscellaneous Functions for Metabarcoding Analysis
-Version: 0.7.1
+Version: 0.7.2
 Authors@R: person("Adrien", "Taudière", email = "adrien.taudiere@zaclys.net",
   role = c("aut", "cre", "cph"), comment = c(ORCID = "0000-0003-1088-1182"))
 Description: The MiscMetabar package aims to facilitate the description, transformation, exploration, and reproducibility of metabarcoding analysis. Mainly build on the top of phyloseq, dada2 R packages. MiscMetabar help to build reproducible and robust bioinformatic pipeline in R. MiscMetabar make ecological analysis of alpha and beta-diversity simple and powerfull by integrating a large number of analysis, some of them from other R packages.  
diff --git a/NEWS.md b/NEWS.md
index 6c634af2..fc971f7d 100644
--- a/NEWS.md
+++ b/NEWS.md
@@ -32,7 +32,7 @@
 - Add functions `get_funguild_db()` and `funguild_assign()` from the [FUNGuildR](https://github.com/brendanf/FUNGuildR/) package into MiscMetabar to decrease package dependencies 
 - Remove all dependencies from packages not available on CRAN or Bioconductor. Improve code using `goodpractice::gp`() and `devtools::check()` function
 - Add messages in various cases (NA in samples data, low number of sequences in samples, low number of sequences by taxa) when using `verify_pq()` with args `verbose=TRUE`
-- Fix a bug in `mutitax_bar_pq()` when using `nb_seq = FALSE`
+- Fix a bug in `multitax_bar_pq()` when using `nb_seq = FALSE`
 
 # MiscMetabar 0.52 
 
diff --git a/R/beta_div_test.R b/R/beta_div_test.R
index 0301cc7a..d57e6e74 100644
--- a/R/beta_div_test.R
+++ b/R/beta_div_test.R
@@ -589,6 +589,16 @@ multipatt_pq <- function(physeq,
 #'   ), color = "darkgrey") +
 #'   geom_point()
 #'
+#' res_time <- ancombc_pq(
+#'    subset_taxa_pq(
+#'      data_fungi_sp_known,
+#'      taxa_sums(data_fungi_sp_known) > 5000
+#'    ),
+#'    fact = "Time",
+#'    levels_fact = c("0", "15"),
+#'    tax_level = "Family",
+#'    verbose = TRUE
+#'  )
 #' @author Adrien Taudière
 #' @details
 #' This function is mainly a wrapper of the work of others.
diff --git a/R/blast.R b/R/blast.R
index 0c2ed144..0bb919fb 100644
--- a/R/blast.R
+++ b/R/blast.R
@@ -45,7 +45,7 @@
 #'
 #' @examples
 #' \dontrun{
-#' # data(data_fungi)
+#' 
 #' blastpath <- "...YOUR_PATH_TO_BLAST..."
 #' blast_to_phyloseq(data_fungi,
 #'   seq2search = system.file("extdata", "ex.fasta",
diff --git a/R/controls.R b/R/controls.R
index 1437efe4..822bb51a 100644
--- a/R/controls.R
+++ b/R/controls.R
@@ -145,7 +145,7 @@ dist_pos_control <- function(physeq, samples_names, method = "bray") {
 #' @export
 #'
 #' @examples
-#' # data(data_fungi)
+#' 
 #'
 #' subset_taxa_tax_control(data_fungi,
 #'   as.numeric(data_fungi@otu_table[, 300]),
diff --git a/R/dada_phyloseq.R b/R/dada_phyloseq.R
index f2d9f2f5..88a41266 100644
--- a/R/dada_phyloseq.R
+++ b/R/dada_phyloseq.R
@@ -437,7 +437,7 @@ track_wkflow <- function(list_of_objects,
 #' @author Adrien Taudière
 #'
 #' @examples
-#' # data(data_fungi)
+#' 
 #' tree_A10_005 <- subset_samples(data_fungi, Tree_name == "A10-005")
 #' track_wkflow_samples(tree_A10_005)
 track_wkflow_samples <- function(list_pq_obj, ...) {
@@ -490,18 +490,27 @@ track_wkflow_samples <- function(list_pq_obj, ...) {
 #' @param tax_adjust (Default 0) See the man page
 #'   of [merge_taxa_vec()] for more details.
 #'   To conserved the taxonomic rank of the most abundant ASV,
-#'   set tax_adjust to 0 (default)
+#'   set tax_adjust to 0 (default). For the moment only tax_adjust = 0 is 
+#'   robust
 #' @param vsearch_cluster_method (default: "--cluster_size) See other possible
 #'   methods in the [vsearch pdf manual](https://github.com/torognes/vsearch/releases/download/v2.23.0/vsearch_manual.pdf) (e.g. `--cluster_size` or `--cluster_smallmem`)
 #'   - `--cluster_fast` : Clusterize the fasta sequences in filename, automatically sort by decreasing sequence length beforehand.
 #'   - `--cluster_size` : Clusterize the fasta sequences in filename, automatically sort by decreasing sequence abundance beforehand.
-#'   - `--cluster_smallmem` : Clusterize the fasta sequences in filename without automatically modifying their order beforehand. Sequence are expected to be sorted by decreasing sequence length, unless *--usersort* is used
+#'   - `--cluster_smallmem` : Clusterize the fasta sequences in filename without automatically modifying their order beforehand. Sequence are expected to be sorted by decreasing sequence length, unless *--usersort* is used.
+#'     In that case you may set `vsearch_args` to vsearch_args = "--strand both --usersort" 
 #' @param vsearch_args (default : "--strand both") a one length character element defining other parameters to
 #'   passed on to vsearch.
 #' @param keep_temporary_files (logical, default: FALSE) Do we keep temporary files
 #'   - temp.fasta (refseq in fasta or dna_seq sequences)
 #'   - cluster.fasta (centroid if method = "vsearch")
 #'   - temp.uc (clusters if method = "vsearch")
+#' @param swarmpath (default: swarm) path to swarm
+#' @param d (default: 1) maximum number of differences allowed between two
+#'   amplicons, meaning that two amplicons will be grouped if they have `d`
+#'   (or less) differences
+#' @param swarm_args (default : "--fastidious") a one length character
+#'   element defining other parameters to  passed on to swarm See other possible
+#'   methods in the [SWARM pdf manual](https://github.com/torognes/swarm/blob/master/man/swarm_manual.pdf)
 #' @param ... Others arguments passed on to [DECIPHER::Clusterize()]
 #' @details This function use the `merge_taxa_vec` function to
 #'   merge taxa into clusters. By default tax_adjust = 0. See the man page
@@ -529,6 +538,9 @@ asv2otu <- function(physeq = NULL,
                     vsearch_cluster_method = "--cluster_size",
                     vsearch_args = "--strand both",
                     keep_temporary_files = FALSE,
+                    swarmpath = "swarm",
+                     d = 1,
+                     swarm_args = "--fastidious",
                     ...) {
   if (inherits(physeq, "phyloseq")) {
     verify_pq(physeq)
@@ -548,10 +560,6 @@ asv2otu <- function(physeq = NULL,
     )
   }
 
-  if (!method %in% c("clusterize", "vsearch", "swarm")) {
-    stop("Method allows 2 values only : `clusterize`, `vsearch` or `swarm`")
-  }
-
   if (method == "clusterize") {
     ## Find clusters of ASVs to form the new OTUs
     clusters <- DECIPHER::Clusterize(dna,
@@ -588,136 +596,25 @@ asv2otu <- function(physeq = NULL,
       keep_temporary_files = keep_temporary_files
     )
   } else if (method == "swarm") {
-
-  }
-  return(new_obj)
-}
-################################################################################
-
-################################################################################
-#' Search for a list of sequence in a fasta file against physeq reference
-#'   sequences using [vsearch](https://github.com/torognes/vsearch)
-#'
-#' `r lifecycle::badge("maturing")`
-#'
-#' @inheritParams clean_pq
-#' @param seq2search (required if path_to_fasta is NULL) Either (i) a DNAstringSet object
-#'   or (ii) a character vector that will be convert to DNAstringSet using
-#'   [Biostrings::DNAStringSet()]
-#' @param path_to_fasta (required if seq2search is NULL) a path to fasta file if seq2search is est to NULL.
-#' @param vsearchpath (default: vsearch) path to vsearch
-#' @param id (default: 0.8) id for the option `--usearch_global` of the vsearch software
-#' @param iddef (default: 0) iddef for the option `--usearch_global` of the vsearch software
-#' @param keep_temporary_files (logical, default: FALSE) Do we keep temporary files
-#'   - temp.fasta (refseq in fasta)
-#'   - cluster.fasta (centroid)
-#'   - temp.uc (clusters)
-#' @examples
-#' \dontrun{
-#' file_dna <- tempfile("dna.fa")
-#' seqinr::write.fasta("GCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTTCA
-#'   ACCCTCAAGCCCCTTATTGCTTGGTGTTGGGAGTTTAGCTGGCTTTATAGCGGTTAACTCCCTAAATATACTGGCG",
-#'   file = file_dna, names = "seq1"
-#' )
-#' # data(data_fungi)
-#' res <- vs_search_global(data_fungi, file_dna)
-#' unlink(file_dna)
-#'
-#' res[res$identity != "*", ]
-#'
-#' clean_pq(subset_taxa(data_fungi, res$identity != "*"))
-#' }
-#' @return A dataframe with uc results (invisible)
-#' @export
-#' @details
-#' This function is mainly a wrapper of the work of others.
-#'   Please cite [vsearch](https://github.com/torognes/vsearch).
-#' @author Adrien Taudière
-
-vs_search_global <- function(physeq,
-                             seq2search = NULL,
-                             path_to_fasta = NULL,
-                             vsearchpath = "vsearch",
-                             id = 0.8,
-                             iddef = 0,
-                             keep_temporary_files = FALSE) {
-  verify_pq(physeq)
-  dna <- Biostrings::DNAStringSet(physeq@refseq)
-  Biostrings::writeXStringSet(dna, paste0(tempdir(), "/", "temp.fasta"))
-
-  if (is.null(seq2search) && is.null(path_to_fasta)) {
-    stop("You must fill either seq2search or path_to_fasta argument.")
-  }
-
-  if (!is.null(seq2search) && !is.null(path_to_fasta)) {
-    stop("You must set either seq2search or path_to_fasta but not both.")
-  }
-  if (!is.null(seq2search)) {
-    if (inherits(seq2search, "character")) {
-      seq2search <- Biostrings::DNAStringSet(seq2search)
-    }
-    Biostrings::writeXStringSet(seq2search, paste0(tempdir(), "seq2search.fasta"))
-    seq2search <- paste0(tempdir(), "seq2search.fasta")
-  } else if (!is.null(path_to_fasta)) {
-    dna <- Biostrings::readDNAStringSet(path_to_fasta)
-    Biostrings::writeXStringSet(dna, paste0(tempdir(), "seq2search.fasta"))
-    seq2search <- paste0(tempdir(), "seq2search.fasta")
-  }
-
-  system2(
-    vsearchpath,
-    paste(
-      " --usearch_global ",
-      paste0(tempdir(), "/", "temp.fasta"),
-      " --db ",
-      seq2search,
-      " --uc ",
-      paste0(tempdir(), "/", "temp.uc"),
-      " --id ",
-      id,
-      " --uc_allhits",
-      " --strand both",
-      " --iddef ",
-      iddef,
-      sep = ""
+    new_obj <- swarm_clustering(
+     physeq = physeq,
+     dna_seq = dna_seq,
+     d = d,
+     swarmpath = swarmpath,
+     vsearch_path = vsearchpath,
+     nproc = nproc,
+     swarm_args = swarm_args,
+     tax_adjust = tax_adjust,
+     keep_temporary_files = keep_temporary_files
     )
-  )
-
-  pack_clusts <-
-    utils::read.table(paste0(tempdir(), "/", "temp.uc"), sep = "\t")
-  colnames(pack_clusts) <- c(
-    "type",
-    "cluster",
-    "width",
-    "identity",
-    "strand",
-    "6",
-    "7",
-    "cigarAlignment",
-    "query",
-    "target"
-  )
-
-  if (!keep_temporary_files) {
-    if (file.exists(paste0(tempdir(), "temp.fasta"))) {
-      unlink(paste0(tempdir(), "temp.fasta"))
-    }
-    if (file.exists(paste0(tempdir(), "temp.uc"))) {
-      unlink(paste0(tempdir(), "temp.uc"))
-    }
-    if (file.exists(paste0(tempdir(), "seq2search.fasta"))) {
-      unlink(paste0(tempdir(), "seq2search.fasta"))
-    }
   } else {
-    message(paste0("Temporary files are located at ", tempdir()))
+    stop("Method allows 2 values only : `clusterize`, `vsearch` or `swarm`")
   }
-
-  return(invisible(pack_clusts))
+  return(new_obj)
 }
 ################################################################################
 
 
-
 ################################################################################
 #' Save phyloseq object in the form of multiple csv tables.
 #'
@@ -753,7 +650,7 @@ vs_search_global <- function(physeq,
 #' @export
 #' @author Adrien Taudière
 #' @examples
-#' # data(data_fungi)
+#' 
 #' # write_pq(data_fungi, path = "phyloseq")
 #' # write_pq(data_fungi, path = "phyloseq", one_file = TRUE)
 #' @seealso [MiscMetabar::save_pq()]
@@ -960,7 +857,7 @@ write_pq <- function(physeq,
 #' @author Adrien Taudière
 #' @examples
 #' \dontrun{
-#' # data(data_fungi)
+#' 
 #' save_pq(data_fungi, path = "phyloseq")
 #' }
 #' @seealso [MiscMetabar::write_pq()]
@@ -1478,7 +1375,7 @@ verify_pq <- function(
 #'   the number of samples
 #'
 #' @examples
-#' # data(data_fungi)
+#' 
 #' cond_samp <- grepl("A1", data_fungi@sam_data[["Sample_names"]])
 #' subset_samples_pq(data_fungi, cond_samp)
 #'
@@ -1532,7 +1429,7 @@ subset_samples_pq <- function(physeq, condition) {
 #'   of this function if you use this parameter. No effect if the condition
 #'   is of class `tax_table`.
 #' @examples
-#' # data(data_fungi)
+#' 
 #' subset_taxa_pq(data_fungi, data_fungi@tax_table[, "Phylum"] == "Ascomycota")
 #'
 #' cond_taxa <- grepl("Endophyte", data_fungi@tax_table[, "Guild"])
@@ -1637,7 +1534,7 @@ subset_taxa_pq <- function(physeq,
 #' @author Adrien Taudière
 #'
 #' @examples
-#' # data(data_fungi)
+#' 
 #' A8_005 <- select_one_sample(data_fungi, "A8-005_S4_MERGED.fastq.gz")
 #' A8_005
 select_one_sample <- function(physeq, sam_name, silent = FALSE) {
@@ -1783,7 +1680,7 @@ tbl_sum_samdata <- function(physeq, remove_col_unique_value = TRUE, ...) {
 #' @export
 #' @author Adrien Taudière
 #' @examples
-#' # data(data_fungi)
+#' 
 #' df <- subset_taxa_pq(data_fungi, taxa_sums(data_fungi) > 5000)
 #' \dontrun{
 #' df <- add_funguild_info(df,
@@ -1852,7 +1749,7 @@ add_funguild_info <- function(physeq,
 #' @author Adrien Taudière
 #' @examples
 #' \dontrun{
-#' # data(data_fungi)
+#' 
 #' df <- subset_taxa_pq(data_fungi, taxa_sums(data_fungi) > 5000)
 #' df <- add_funguild_info(df,
 #'   taxLevels = c(
@@ -2015,7 +1912,7 @@ plot_guild_pq <-
 #'   use this function.
 #' @examples
 #' library("phangorn")
-#' # data(data_fungi)
+#' 
 #' df <- subset_taxa_pq(data_fungi, taxa_sums(data_fungi) > 9000)
 #' df_tree <- build_phytree_pq(df, nb_bootstrap = 5)
 #' plot(df_tree$UPGMA)
@@ -2152,7 +2049,7 @@ build_phytree_pq <- function(physeq,
 #' @author Adrien Taudière
 #' @importFrom stats kruskal.test
 #' @examples
-#' # data(data_fungi)
+#' 
 #' are_modality_even_depth(data_fungi, "Time")$p.value
 #' are_modality_even_depth(rarefy_even_depth(data_fungi), "Time")$p.value
 #' are_modality_even_depth(data_fungi, "Height", boxplot = TRUE)
@@ -2190,7 +2087,7 @@ are_modality_even_depth <- function(physeq, fact, boxplot = FALSE) {
 #' @export
 #' @author Adrien Taudière
 #' @examples
-#' # data(data_fungi)
+#' 
 #' data_fungi_ordered_by_genus <- reorder_taxa_pq(
 #'   data_fungi,
 #'   taxa_names(data_fungi)[order(as.vector(data_fungi@tax_table[, "Genus"]))]
@@ -2262,7 +2159,7 @@ reorder_taxa_pq <- function(physeq, names_ordered, remove_phy_tree = FALSE) {
 #' @export
 #'
 #' @examples
-#' # data(data_fungi)
+#' 
 #' data_fungi <- add_info_to_sam_data(data_fungi)
 #' boxplot(data_fungi@sam_data$nb_otu ~ data_fungi@sam_data$Time)
 #'
@@ -2301,214 +2198,6 @@ add_info_to_sam_data <- function(physeq,
 ################################################################################
 
 
-
-###############################################################################
-#' Re-cluster sequences of an object of class `physeq`
-#'   or cluster a list of DNA sequences using SWARM
-#'
-#' @description
-#' `r lifecycle::badge("maturing")`
-#'
-#' @inheritParams clean_pq
-#' @param dna_seq NOT WORKING FOR THE MOMENT
-#'   You may directly use a character vector of DNA sequences
-#'   in place of physeq args. When physeq is set, dna sequences take the value of
-#'   `physeq@refseq`
-#' @param d (default: 1) maximum number of differences allowed between two
-#'   amplicons, meaning that two amplicons will be grouped if they have `d`
-#'   (or less) differences
-#' @param swarmpath (default: swarm) path to swarm
-#' @param vsearch_path (default: vsearch) path to vsearch, used only if physeq
-#'   is NULL and dna_seq is provided.
-#' @param nproc (default: 1)
-#'   Set to number of cpus/processors to use for the clustering
-#' @param swarm_args (default : "--fastidious") a one length character
-#'   element defining other parameters to  passed on to swarm See other possible
-#'   methods in the [SWARM pdf manual](https://github.com/torognes/swarm/blob/master/man/swarm_manual.pdf)
-#' @param tax_adjust (Default 0) See the man page
-#'   of [merge_taxa_vec()] for more details.
-#'   To conserved the taxonomic rank of the most abundant ASV,
-#' @param keep_temporary_files (logical, default: FALSE) Do we keep temporary
-#'   files ?
-#'   - temp.fasta (refseq in fasta or dna_seq sequences)
-#'   - temp_output (classical output of SWARM)
-#'   - temp_uclust (clusters output of SWARM)
-#' @details This function use the `merge_taxa_vec` function to
-#'   merge taxa into clusters. By default tax_adjust = 0. See the man page
-#'   of [merge_taxa_vec()].
-#' @return A new object of class `physeq` or a list of cluster if dna_seq
-#'   args was used.
-#'
-#' @references
-#'   SWARM can be downloaded from
-#'   \url{https://github.com/torognes/swarm/}.
-#'
-#' @export
-#' @examples
-#' \dontrun{
-#' # data(data_fungi)
-#' summary_plot_pq(data_fungi)
-#' # Change with your PATH
-#' path_to_swarm <- "/home/adrien/miniconda3/bin/swarm"
-#'
-#' data_fungi_swarm <- swarm_clustering(data_fungi, swarmpath = path_to_swarm)
-#' summary_plot_pq(data_fungi_swarm)
-#'
-#' sequences_ex <- c(
-#'   "TACCTATGTTGCCTTGGCGGCTAAACCTACCCGGGATTTGATGGGGCGAATTAATAACGAATTCATTGAATCA",
-#'   "TACCTATGTTGCCTTGGCGGCTAAACCTACCCGGGATTTGATGGGGCGAATTACCTGGTAAGGCCCACTT",
-#'   "TACCTATGTTGCCTTGGCGGCTAAACCTACCCGGGATTTGATGGGGCGAATTACCTGGTAGAGGTG",
-#'   "TACCTATGTTGCCTTGGCGGCTAAACCTACC",
-#'   "CGGGATTTGATGGCGAATTACCTGGTATTTTAGCCCACTTACCCGGTACCATGAGGTG",
-#'   "GCGGCTAAACCTACCCGGGATTTGATGGCGAATTACCTGG",
-#'   "GCGGCTAAACCTACCCGGGATTTGATGGCGAATTACAAAG",
-#'   "GCGGCTAAACCTACCCGGGATTTGATGGCGAATTACAAAG",
-#'   "GCGGCTAAACCTACCCGGGATTTGATGGCGAATTACAAAG"
-#' )
-#'
-#' sequences_ex_swarm <- swarm_clustering(
-#'   dna_seq = sequences_ex,
-#'   swarmpath = path_to_swarm
-#' )
-#' }
-#' @seealso [asv2otu()], [vsearch_clustering()]
-#' @references
-#'   SWARM can be downloaded from
-#'   \url{https://github.com/torognes/swarm}.
-#'   More information in the associated publications
-#'   \url{https://doi.org/10.1093/bioinformatics/btab493} and
-#'   \url{https://doi.org/10.7717%2Fpeerj.593}.
-#' @details
-#' This function is mainly a wrapper of the work of others.
-#'   Please cite [SWARM](https://github.com/torognes/swarm).
-
-swarm_clustering <- function(physeq = NULL,
-                             dna_seq = NULL,
-                             d = 1,
-                             swarmpath = "swarm",
-                             vsearch_path = "vsearch",
-                             nproc = 1,
-                             swarm_args = "--fastidious",
-                             tax_adjust = 0,
-                             keep_temporary_files = FALSE) {
-  dna <- physeq_or_string_to_dna(
-    physeq = physeq,
-    dna_seq = dna_seq
-  )
-
-  if (!is.null(physeq)) {
-    nseq <- taxa_sums(physeq)
-    nseq <- nseq[match(names(nseq), names(dna))]
-    names(dna) <- paste0(names(dna), "_", nseq)
-    Biostrings::writeXStringSet(dna, paste0(tempdir(), "/", "temp.fasta"))
-    system2(
-      swarmpath,
-      paste0(
-        paste0(tempdir(), "/", "temp.fasta"),
-        " -o ",
-        paste0(tempdir(), "/", "temp_output"),
-        " ",
-        " -u ",
-        paste0(tempdir(), "/", "temp_uclust"),
-        " -t ",
-        nproc,
-        " ",
-        swarm_args
-      ),
-      stdout = TRUE,
-      stderr = TRUE
-    )
-  } else {
-    Biostrings::writeXStringSet(dna, paste0(tempdir(), "/", "amplicons.fasta"))
-    system2(
-      vsearch_path,
-      paste0(
-        " --derep_fulllength ",
-        paste0(tempdir(), "/", "amplicons.fasta"),
-        " --sizeout  --relabel_sha1 --fasta_width 0 --output ",
-        paste0(tempdir(), "/", "temp.fasta")
-      ),
-      stdout = TRUE,
-      stderr = TRUE
-    )
-    system2(
-      swarmpath,
-      paste0(
-        paste0(tempdir(), "/", "temp.fasta"),
-        " -o ",
-        paste0(tempdir(), "/", "temp_output"),
-        " ",
-        " -u ",
-        paste0(tempdir(), "/", "temp_uclust"),
-        " -z ",
-        " -t ",
-        nproc,
-        " ",
-        swarm_args
-      ),
-      stdout = TRUE,
-      stderr = TRUE
-    )
-  }
-
-  pack_clusts <-
-    utils::read.table(paste0(tempdir(), "/", "temp_uclust"), sep = "\t")
-  colnames(pack_clusts) <-
-    c(
-      "type",
-      "cluster",
-      "width",
-      "identity",
-      "strand",
-      "6",
-      "7",
-      "cigarAlignment",
-      "query",
-      "target"
-    )
-
-  if (inherits(physeq, "phyloseq")) {
-    clusters <- pack_clusts$cluster[pack_clusts$type != "C"]
-    names(clusters) <-
-      sub("_.*$", "", pack_clusts$query[pack_clusts$type != "C"])
-
-    clusters <- clusters[match(taxa_names(physeq), names(clusters))]
-
-    new_obj <-
-      merge_taxa_vec(physeq,
-        clusters,
-        tax_adjust = tax_adjust
-      )
-  } else if (inherits(dna_seq, "character")) {
-    new_obj <- pack_clusts
-  } else {
-    stop(
-      "You must set the args physeq (object of class phyloseq) or
-      dna_seq (character vector)."
-    )
-  }
-
-  if (file.exists(paste0(tempdir(), "/", "temp.fasta")) &&
-    !keep_temporary_files) {
-    unlink(paste0(tempdir(), "/", "temp.fasta"))
-  }
-  if (file.exists(paste0(tempdir(), "/", "temp_output")) &&
-    !keep_temporary_files) {
-    unlink(paste0(tempdir(), "/", "temp_output"))
-  }
-  if (file.exists(paste0(tempdir(), "/", "temp_uclust")) &&
-    !keep_temporary_files) {
-    unlink(paste0(tempdir(), "/", "temp_uclust"))
-  }
-  if (file.exists(paste0(tempdir(), "/", "amplicon.fasta")) &&
-    !keep_temporary_files) {
-    unlink(paste0(tempdir(), "/", "amplicon.fasta"))
-  }
-  return(new_obj)
-}
-###############################################################################
-
-
 ###############################################################################
 #' Return a DNAStringSet object from either a character vector of DNA sequences
 #'   or the `refseq` slot of a phyloseq-class object
@@ -2529,7 +2218,7 @@ swarm_clustering <- function(physeq = NULL,
 #' @export
 #'
 #' @examples
-#' # data(data_fungi)
+#' 
 #' dna <- physeq_or_string_to_dna(data_fungi)
 #' dna
 #'
@@ -2573,147 +2262,6 @@ physeq_or_string_to_dna <- function(physeq = NULL,
 ###############################################################################
 
 
-###############################################################################
-#' Recluster sequences of an object of class `physeq`
-#'   or cluster a list of DNA sequences using vsearch software
-#'
-#' @description
-#' `r lifecycle::badge("maturing")`
-#'
-#' @inheritParams clean_pq
-#' @param dna_seq You may directly use a character vector of DNA sequences
-#'   in place of physeq args. When physeq is set, dna sequences take the value of
-#'   `physeq@refseq`
-#' @param nproc (default: 1)
-#'   Set to number of cpus/processors to use for the clustering
-#' @param id (default: 0.97) level of identity to cluster
-#' @param vsearchpath (default: vsearch) path to vsearch
-#' @param tax_adjust (Default 0) See the man page
-#'   of [merge_taxa_vec()] for more details.
-#'   To conserved the taxonomic rank of the most abundant ASV,
-#'   set tax_adjust to 0 (default)
-#' @param vsearch_cluster_method (default: "--cluster_size) See other possible
-#'   methods in the [vsearch pdf manual](https://github.com/torognes/vsearch/releases/download/v2.23.0/vsearch_manual.pdf) (e.g. `--cluster_size` or `--cluster_smallmem`)
-#'   - `--cluster_fast` : Clusterize the fasta sequences in filename, automatically sort by decreasing sequence length beforehand.
-#'   - `--cluster_size` : Clusterize the fasta sequences in filename, automatically sort by decreasing sequence abundance beforehand.
-#'   - `--cluster_smallmem` : Clusterize the fasta sequences in filename without automatically modifying their order beforehand. Sequence are expected to be sorted by decreasing sequence length, unless *--usersort* is used
-#' @param vsearch_args (default : "--strand both") a one length character element defining other parameters to
-#'   passed on to vsearch.
-#' @param keep_temporary_files (logical, default: FALSE) Do we keep temporary files ?
-#'   - temp.fasta (refseq in fasta or dna_seq sequences)
-#'   - cluster.fasta (centroid if method = "vsearch")
-#'   - temp.uc (clusters if method = "vsearch")
-#'
-#' @seealso [asv2otu()], [swarm_clustering()]
-#' @details This function use the [merge_taxa_vec()] function to
-#'   merge taxa into clusters. By default tax_adjust = 0. See the man page
-#'   of [merge_taxa_vec()].
-#'
-#' @return A new object of class `physeq` or a list of cluster if dna_seq
-#'   args was used.
-#'
-#' @references
-#'   VSEARCH can be downloaded from
-#'   \url{https://github.com/torognes/vsearch}.
-#'   More information in the associated publication
-#'   \url{https://pubmed.ncbi.nlm.nih.gov/27781170}.
-#' @export
-#' @author Adrien Taudière
-#'
-#' @examples
-#' # data(data_fungi)
-#' summary_plot_pq(data_fungi)
-#' d_vs <- vsearch_clustering(data_fungi)
-#' summary_plot_pq(d_vs)
-#' @details
-#' This function is mainly a wrapper of the work of others.
-#'   Please cite [vsearch](https://github.com/torognes/vsearch).
-vsearch_clustering <- function(physeq = NULL,
-                               dna_seq = NULL,
-                               nproc = 1,
-                               id = 0.97,
-                               vsearchpath = "vsearch",
-                               tax_adjust = 0,
-                               vsearch_cluster_method = "--cluster_size",
-                               vsearch_args = "--strand both",
-                               keep_temporary_files = FALSE) {
-  dna <- physeq_or_string_to_dna(physeq = physeq, dna_seq = dna_seq)
-
-  Biostrings::writeXStringSet(dna, paste0(tempdir(), "/", "temp.fasta"))
-
-  system2(
-    vsearchpath,
-    paste0(
-      paste0(
-        " ",
-        vsearch_cluster_method,
-        " ",
-        paste0(tempdir(), "/", "temp.fasta"),
-        " ",
-        vsearch_args
-      ),
-      " -id ",
-      id,
-      " --centroids ",
-      paste0(tempdir(), "/", "cluster.fasta"),
-      " --uc ",
-      paste0(tempdir(), "/", "temp.uc")
-    ),
-    stdout = TRUE,
-    stderr = TRUE
-  )
-
-  pack_clusts <-
-    utils::read.table(paste0(tempdir(), "/", "temp.uc"), sep = "\t")
-  colnames(pack_clusts) <-
-    c(
-      "type",
-      "cluster",
-      "width",
-      "identity",
-      "strand",
-      "6",
-      "7",
-      "cigarAlignment",
-      "query",
-      "target"
-    )
-
-  clusters <- pack_clusts$cluster[pack_clusts$type != "C"]
-  names(clusters) <- pack_clusts$query[pack_clusts$type != "C"]
-  clusters <- clusters[match(taxa_names(physeq), names(clusters))]
-
-  if (inherits(physeq, "phyloseq")) {
-    new_obj <-
-      merge_taxa_vec(physeq,
-        clusters,
-        tax_adjust = tax_adjust
-      )
-  } else if (inherits(dna_seq, "character")) {
-    new_obj <- pack_clusts
-  } else {
-    stop(
-      "You must set the args physeq (object of class phyloseq) or dna_seq (character vector)."
-    )
-  }
-
-  if (file.exists(paste0(tempdir(), "/", "temp.fasta")) &&
-    !keep_temporary_files) {
-    unlink(paste0(tempdir(), "/", "temp.fasta"))
-  }
-  if (file.exists(paste0(tempdir(), "/", "cluster.fasta")) &&
-    !keep_temporary_files) {
-    unlink(paste0(tempdir(), "/", "cluster.fasta"))
-  }
-  if (file.exists(paste0(tempdir(), "/", "temp.uc")) &&
-    !keep_temporary_files) {
-    unlink(paste0(tempdir(), "/", "temp.uc"))
-  }
-  return(new_obj)
-}
-###############################################################################
-
-
 
 ################################################################################
 #' Remove primers using [cutadapt](https://github.com/marcelm/cutadapt/)
diff --git a/R/plot_functions.R b/R/plot_functions.R
index 62fe7acd..ba303903 100644
--- a/R/plot_functions.R
+++ b/R/plot_functions.R
@@ -10,7 +10,7 @@
 #' @param taxa (default: "Species") The taxonomic level you choose for x-positioning.
 #' @author Adrien Taudière
 #' @examples
-#' # data(data_fungi)
+#' 
 #' # Filter samples that don't have Enterotype
 #' data_fungi <- subset_samples(data_fungi, !is.na(Time))
 #' res <- mt(data_fungi, "Time", method = "fdr", test = "f", B = 300)
@@ -978,7 +978,7 @@ venn_pq <-
 #'   of plots.
 #' @seealso [upset_pq()]
 #' @examples
-#' # data(data_fungi)
+#' 
 #' ggvenn_pq(data_fungi, fact = "Height")
 #' ggvenn_pq(data_fungi, fact = "Height") +
 #'   ggplot2::scale_fill_distiller(palette = "BuPu", direction = 1)
@@ -1213,7 +1213,7 @@ multiplot <-
 #' @export
 #' @author Adrien Taudière
 #' @examples
-#' # data(data_fungi)
+#' 
 #' p <- hill_pq(data_fungi, "Height")
 #' p_h1 <- p[[1]] + theme(legend.position = "none")
 #' p_h2 <- p[[2]] + theme(legend.position = "none")
@@ -1440,7 +1440,6 @@ hill_pq <-
 #'
 #' @export
 #' @examples
-#' data(data_fungi)
 #' p <- ggbetween_pq(data_fungi, variable = "Time", p.adjust.method = "BH")
 #' p[[1]]
 #' ggbetween_pq(data_fungi, variable = "Height", one_plot = TRUE)
@@ -1513,7 +1512,7 @@ ggbetween_pq <- function(physeq, variable, one_plot = FALSE, rarefy_by_sample =
 #' @param clean_pq (logical): Does the phyloseq
 #'   object is cleaned using the [clean_pq()] function?
 #' @examples
-#' # data(data_fungi)
+#' 
 #' summary_plot_pq(data_fungi)
 #' summary_plot_pq(data_fungi, add_info = FALSE) + scale_fill_viridis_d()
 #' @return A ggplot2 object
@@ -1861,7 +1860,7 @@ heat_tree_pq <- function(physeq, taxonomic_level = NULL, ...) {
 #' @return A plot
 #'
 #' @examples
-#' # data(data_fungi)
+#' 
 #' data_fungi_2Height <- subset_samples(data_fungi, Height %in% c("Low", "High"))
 #' biplot_pq(data_fungi_2Height, "Height", merge_sample_by = "Height")
 #' @export
@@ -2113,7 +2112,7 @@ biplot_pq <- function(physeq,
 #' @export
 #'
 #' @examples
-#' # data(data_fungi)
+#' 
 #' data_fungi_abun <- subset_taxa_pq(data_fungi, taxa_sums(data_fungi) > 10000)
 #' p <- multi_biplot_pq(data_fungi_abun, "Height")
 #' lapply(p, print)
@@ -2496,7 +2495,7 @@ multitax_bar_pq <- function(physeq,
 #' @export
 #'
 #' @examples
-#' # data(data_fungi)
+#' 
 #' res_tsne <- tsne_pq(data_fungi)
 tsne_pq <-
   function(physeq,
@@ -2747,7 +2746,7 @@ iNEXT_pq <- function(physeq,
 #'
 #' @seealso [ggvenn_pq()]
 #' @examples
-#' # data(data_fungi)
+#' 
 #' upset_pq(data_fungi, fact = "Height", width_ratio = 0.2)
 #' upset_pq(data_fungi,
 #'   fact = "Height", width_ratio = 0.2,
@@ -3016,7 +3015,7 @@ upset_test_pq <-
 #' @export
 #'
 #' @examples
-#' # data(data_fungi)
+#' 
 #' diff_fct_diff_class(
 #'   data_fungi@sam_data$Sample_id,
 #'   numeric_fonction = sum,
@@ -3133,7 +3132,7 @@ diff_fct_diff_class <-
 #' @export
 #'
 #' @examples
-#' # data(data_fungi)
+#' 
 #' data_fungi_ab <- subset_taxa_pq(data_fungi, taxa_sums(data_fungi) > 10000)
 #' tax_bar_pq(data_fungi_ab) + theme(legend.position = "none")
 #' tax_bar_pq(data_fungi_ab, taxa = "Class")
@@ -3183,8 +3182,7 @@ tax_bar_pq <- function(physeq, fact = "Sample", taxa = "Order", percent_bar = FA
 #' @export
 #' @author Adrien Taudière
 #' @examples
-#' data(data_fungi)
-#' data(data_fungi_sp_known)
+#' 
 #' ridges_pq(data_fungi, "Time", alpha = 0.5, log10trans = FALSE) + xlim(c(0, 1000))
 #' ridges_pq(data_fungi, "Time", alpha = 0.5)
 #' ridges_pq(
diff --git a/R/table_functions.R b/R/table_functions.R
index 430bda31..c432708e 100644
--- a/R/table_functions.R
+++ b/R/table_functions.R
@@ -114,7 +114,7 @@ tax_datatable <- function(physeq,
 #' @importFrom rlang .data
 #' @export
 #' @examples
-#' # data(data_fungi)
+#' 
 #' data_fungi_low_high <- subset_samples(data_fungi, Height %in% c("Low", "High"))
 #' compare_pairs_pq(data_fungi_low_high, bifactor = "Height", merge_sample_by = "Height")
 #' compare_pairs_pq(data_fungi_low_high,
diff --git a/R/targets_misc.R b/R/targets_misc.R
index c9160d9d..ca4f34be 100644
--- a/R/targets_misc.R
+++ b/R/targets_misc.R
@@ -63,7 +63,7 @@ list_fastq_files <-
 #' @author Adrien Taudière
 #'
 #' @examples
-#' # data(data_fungi)
+#' 
 #' rename_samples_otu_table(data_fungi, as.character(seq_along(sample_names(data_fungi))))
 #'
 rename_samples_otu_table <- function(physeq, names_of_samples) {
diff --git a/R/vsearch.R b/R/vsearch.R
index 2ea3707a..ca210ed5 100644
--- a/R/vsearch.R
+++ b/R/vsearch.R
@@ -1,3 +1,477 @@
+
+################################################################################
+#' Search for a list of sequence in a fasta file against physeq reference
+#'   sequences using [vsearch](https://github.com/torognes/vsearch)
+#'
+#' `r lifecycle::badge("maturing")`
+#'
+#' @inheritParams clean_pq
+#' @param seq2search (required if path_to_fasta is NULL) Either (i) a DNAstringSet object
+#'   or (ii) a character vector that will be convert to DNAstringSet using
+#'   [Biostrings::DNAStringSet()]
+#' @param path_to_fasta (required if seq2search is NULL) a path to fasta file if seq2search is est to NULL.
+#' @param vsearchpath (default: vsearch) path to vsearch
+#' @param id (default: 0.8) id for the option `--usearch_global` of the vsearch software
+#' @param iddef (default: 0) iddef for the option `--usearch_global` of the vsearch software
+#' @param keep_temporary_files (logical, default: FALSE) Do we keep temporary files
+#'   - temp.fasta (refseq in fasta)
+#'   - cluster.fasta (centroid)
+#'   - temp.uc (clusters)
+#' @examples
+#' \dontrun{
+#' file_dna <- tempfile("dna.fa")
+#' seqinr::write.fasta("GCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTTCA
+#'   ACCCTCAAGCCCCTTATTGCTTGGTGTTGGGAGTTTAGCTGGCTTTATAGCGGTTAACTCCCTAAATATACTGGCG",
+#'   file = file_dna, names = "seq1"
+#' )
+#' 
+#' res <- vs_search_global(data_fungi, file_dna)
+#' unlink(file_dna)
+#'
+#' res[res$identity != "*", ]
+#'
+#' clean_pq(subset_taxa(data_fungi, res$identity != "*"))
+#' }
+#' @return A dataframe with uc results (invisible)
+#' @export
+#' @details
+#' This function is mainly a wrapper of the work of others.
+#'   Please cite [vsearch](https://github.com/torognes/vsearch).
+#' @author Adrien Taudière
+
+vs_search_global <- function(physeq,
+                             seq2search = NULL,
+                             path_to_fasta = NULL,
+                             vsearchpath = "vsearch",
+                             id = 0.8,
+                             iddef = 0,
+                             keep_temporary_files = FALSE) {
+  verify_pq(physeq)
+  dna <- Biostrings::DNAStringSet(physeq@refseq)
+  Biostrings::writeXStringSet(dna, paste0(tempdir(), "/", "temp.fasta"))
+
+  if (is.null(seq2search) && is.null(path_to_fasta)) {
+    stop("You must fill either seq2search or path_to_fasta argument.")
+  }
+
+  if (!is.null(seq2search) && !is.null(path_to_fasta)) {
+    stop("You must set either seq2search or path_to_fasta but not both.")
+  }
+  if (!is.null(seq2search)) {
+    if (inherits(seq2search, "character")) {
+      seq2search <- Biostrings::DNAStringSet(seq2search)
+    }
+    Biostrings::writeXStringSet(seq2search, paste0(tempdir(), "seq2search.fasta"))
+    seq2search <- paste0(tempdir(), "seq2search.fasta")
+  } else if (!is.null(path_to_fasta)) {
+    dna <- Biostrings::readDNAStringSet(path_to_fasta)
+    Biostrings::writeXStringSet(dna, paste0(tempdir(), "seq2search.fasta"))
+    seq2search <- paste0(tempdir(), "seq2search.fasta")
+  }
+
+  system2(
+    vsearchpath,
+    paste(
+      " --usearch_global ",
+      paste0(tempdir(), "/", "temp.fasta"),
+      " --db ",
+      seq2search,
+      " --uc ",
+      paste0(tempdir(), "/", "temp.uc"),
+      " --id ",
+      id,
+      " --uc_allhits",
+      " --strand both",
+      " --iddef ",
+      iddef,
+      sep = ""
+    )
+  )
+
+  pack_clusts <-
+    utils::read.table(paste0(tempdir(), "/", "temp.uc"), sep = "\t")
+  colnames(pack_clusts) <- c(
+    "type",
+    "cluster",
+    "width",
+    "identity",
+    "strand",
+    "6",
+    "7",
+    "cigarAlignment",
+    "query",
+    "target"
+  )
+
+  if (!keep_temporary_files) {
+    if (file.exists(paste0(tempdir(), "temp.fasta"))) {
+      unlink(paste0(tempdir(), "temp.fasta"))
+    }
+    if (file.exists(paste0(tempdir(), "temp.uc"))) {
+      unlink(paste0(tempdir(), "temp.uc"))
+    }
+    if (file.exists(paste0(tempdir(), "seq2search.fasta"))) {
+      unlink(paste0(tempdir(), "seq2search.fasta"))
+    }
+  } else {
+    message(paste0("Temporary files are located at ", tempdir()))
+  }
+
+  return(invisible(pack_clusts))
+}
+################################################################################
+
+
+
+###############################################################################
+#' Re-cluster sequences of an object of class `physeq`
+#'   or cluster a list of DNA sequences using SWARM
+#'
+#' @description
+#' `r lifecycle::badge("maturing")`
+#'
+#' @inheritParams clean_pq
+#' @param dna_seq NOT WORKING FOR THE MOMENT
+#'   You may directly use a character vector of DNA sequences
+#'   in place of physeq args. When physeq is set, dna sequences take the value of
+#'   `physeq@refseq`
+#' @param d (default: 1) maximum number of differences allowed between two
+#'   amplicons, meaning that two amplicons will be grouped if they have `d`
+#'   (or less) differences
+#' @param swarmpath (default: swarm) path to swarm
+#' @param vsearch_path (default: vsearch) path to vsearch, used only if physeq
+#'   is NULL and dna_seq is provided.
+#' @param nproc (default: 1)
+#'   Set to number of cpus/processors to use for the clustering
+#' @param swarm_args (default : "--fastidious") a one length character
+#'   element defining other parameters to  passed on to swarm See other possible
+#'   methods in the [SWARM pdf manual](https://github.com/torognes/swarm/blob/master/man/swarm_manual.pdf)
+#' @param tax_adjust (Default 0) See the man page
+#'   of [merge_taxa_vec()] for more details.
+#'   To conserved the taxonomic rank of the most abundant ASV,
+#' @param keep_temporary_files (logical, default: FALSE) Do we keep temporary
+#'   files ?
+#'   - temp.fasta (refseq in fasta or dna_seq sequences)
+#'   - temp_output (classical output of SWARM)
+#'   - temp_uclust (clusters output of SWARM)
+#' @details This function use the `merge_taxa_vec` function to
+#'   merge taxa into clusters. By default tax_adjust = 0. See the man page
+#'   of [merge_taxa_vec()].
+#' @return A new object of class `physeq` or a list of cluster if dna_seq
+#'   args was used.
+#'
+#' @references
+#'   SWARM can be downloaded from
+#'   \url{https://github.com/torognes/swarm/}.
+#'
+#' @export
+#' @examples
+#' \dontrun{
+#' 
+#' summary_plot_pq(data_fungi)
+#' system2("swarm", "-h")
+#' 
+#' data_fungi_swarm <- swarm_clustering(data_fungi)
+#' summary_plot_pq(data_fungi_swarm)
+#'
+#' sequences_ex <- c(
+#'   "TACCTATGTTGCCTTGGCGGCTAAACCTACCCGGGATTTGATGGGGCGAATTAATAACGAATTCATTGAATCA",
+#'   "TACCTATGTTGCCTTGGCGGCTAAACCTACCCGGGATTTGATGGGGCGAATTACCTGGTAAGGCCCACTT",
+#'   "TACCTATGTTGCCTTGGCGGCTAAACCTACCCGGGATTTGATGGGGCGAATTACCTGGTAGAGGTG",
+#'   "TACCTATGTTGCCTTGGCGGCTAAACCTACC",
+#'   "CGGGATTTGATGGCGAATTACCTGGTATTTTAGCCCACTTACCCGGTACCATGAGGTG",
+#'   "GCGGCTAAACCTACCCGGGATTTGATGGCGAATTACCTGG",
+#'   "GCGGCTAAACCTACCCGGGATTTGATGGCGAATTACAAAG",
+#'   "GCGGCTAAACCTACCCGGGATTTGATGGCGAATTACAAAG",
+#'   "GCGGCTAAACCTACCCGGGATTTGATGGCGAATTACAAAG"
+#' )
+#'
+#' sequences_ex_swarm <- swarm_clustering(
+#'   dna_seq = sequences_ex
+#' )
+#' }
+#' @seealso [asv2otu()], [vsearch_clustering()]
+#' @references
+#'   SWARM can be downloaded from
+#'   \url{https://github.com/torognes/swarm}.
+#'   More information in the associated publications
+#'   \url{https://doi.org/10.1093/bioinformatics/btab493} and
+#'   \url{https://doi.org/10.7717%2Fpeerj.593}.
+#' @details
+#' This function is mainly a wrapper of the work of others.
+#'   Please cite [SWARM](https://github.com/torognes/swarm).
+
+swarm_clustering <- function(physeq = NULL,
+                             dna_seq = NULL,
+                             d = 1,
+                             swarmpath = "swarm",
+                             vsearch_path = "vsearch",
+                             nproc = 1,
+                             swarm_args = "--fastidious",
+                             tax_adjust = 0,
+                             keep_temporary_files = FALSE) {
+  dna <- physeq_or_string_to_dna(
+    physeq = physeq,
+    dna_seq = dna_seq
+  )
+
+  if (!is.null(physeq)) {
+    nseq <- taxa_sums(physeq)
+    nseq <- nseq[match(names(nseq), names(dna))]
+    names(dna) <- paste0(names(dna), "_", nseq)
+    Biostrings::writeXStringSet(dna, paste0(tempdir(), "/", "temp.fasta"))
+    system2(
+      swarmpath,
+      paste0(
+        paste0(tempdir(), "/", "temp.fasta"),
+        " -o ",
+        paste0(tempdir(), "/", "temp_output"),
+        " ",
+        " -u ",
+        paste0(tempdir(), "/", "temp_uclust"),
+        " -t ",
+        nproc,
+        " ",
+        swarm_args
+      ),
+      stdout = TRUE,
+      stderr = TRUE
+    )
+  } else {
+    Biostrings::writeXStringSet(dna, paste0(tempdir(), "/", "amplicons.fasta"))
+    system2(
+      vsearch_path,
+      paste0(
+        " --derep_fulllength ",
+        paste0(tempdir(), "/", "amplicons.fasta"),
+        " --sizeout  --relabel_sha1 --fasta_width 0 --output ",
+        paste0(tempdir(), "/", "temp.fasta")
+      ),
+      stdout = TRUE,
+      stderr = TRUE
+    )
+    system2(
+      swarmpath,
+      paste0(
+        paste0(tempdir(), "/", "temp.fasta"),
+        " -o ",
+        paste0(tempdir(), "/", "temp_output"),
+        " ",
+        " -u ",
+        paste0(tempdir(), "/", "temp_uclust"),
+        " -z ",
+        " -t ",
+        nproc,
+        " ",
+        swarm_args
+      ),
+      stdout = TRUE,
+      stderr = TRUE
+    )
+  }
+
+  pack_clusts <-
+    utils::read.table(paste0(tempdir(), "/", "temp_uclust"), sep = "\t")
+  colnames(pack_clusts) <-
+    c(
+      "type",
+      "cluster",
+      "width",
+      "identity",
+      "strand",
+      "6",
+      "7",
+      "cigarAlignment",
+      "query",
+      "target"
+    )
+
+  if (inherits(physeq, "phyloseq")) {
+    clusters <- pack_clusts$cluster[pack_clusts$type != "C"]
+    names(clusters) <-
+      sub("_.*$", "", pack_clusts$query[pack_clusts$type != "C"])
+
+    clusters <- clusters[match(taxa_names(physeq), names(clusters))]
+
+    new_obj <-
+      merge_taxa_vec(physeq,
+        clusters,
+        tax_adjust = tax_adjust
+      )
+  } else if (inherits(dna_seq, "character")) {
+    new_obj <- pack_clusts
+  } else {
+    stop(
+      "You must set the args physeq (object of class phyloseq) or
+      dna_seq (character vector)."
+    )
+  }
+
+  if (file.exists(paste0(tempdir(), "/", "temp.fasta")) &&
+    !keep_temporary_files) {
+    unlink(paste0(tempdir(), "/", "temp.fasta"))
+  }
+  if (file.exists(paste0(tempdir(), "/", "temp_output")) &&
+    !keep_temporary_files) {
+    unlink(paste0(tempdir(), "/", "temp_output"))
+  }
+  if (file.exists(paste0(tempdir(), "/", "temp_uclust")) &&
+    !keep_temporary_files) {
+    unlink(paste0(tempdir(), "/", "temp_uclust"))
+  }
+  if (file.exists(paste0(tempdir(), "/", "amplicon.fasta")) &&
+    !keep_temporary_files) {
+    unlink(paste0(tempdir(), "/", "amplicon.fasta"))
+  }
+  return(new_obj)
+}
+###############################################################################
+
+
+
+###############################################################################
+#' Recluster sequences of an object of class `physeq`
+#'   or cluster a list of DNA sequences using vsearch software
+#'
+#' @description
+#' `r lifecycle::badge("maturing")`
+#'
+#' @inheritParams clean_pq
+#' @param dna_seq You may directly use a character vector of DNA sequences
+#'   in place of physeq args. When physeq is set, dna sequences take the value of
+#'   `physeq@refseq`
+#' @param nproc (default: 1)
+#'   Set to number of cpus/processors to use for the clustering
+#' @param id (default: 0.97) level of identity to cluster
+#' @param vsearchpath (default: vsearch) path to vsearch
+#' @param tax_adjust (Default 0) See the man page
+#'   of [merge_taxa_vec()] for more details.
+#'   To conserved the taxonomic rank of the most abundant ASV,
+#'   set tax_adjust to 0 (default). For the moment only tax_adjust = 0 is 
+#'   robust
+#' @param vsearch_cluster_method (default: "--cluster_size) See other possible
+#'   methods in the [vsearch pdf manual](https://github.com/torognes/vsearch/releases/download/v2.23.0/vsearch_manual.pdf) (e.g. `--cluster_size` or `--cluster_smallmem`)
+#'   - `--cluster_fast` : Clusterize the fasta sequences in filename, automatically sort by decreasing sequence length beforehand.
+#'   - `--cluster_size` : Clusterize the fasta sequences in filename, automatically sort by decreasing sequence abundance beforehand.
+#'   - `--cluster_smallmem` : Clusterize the fasta sequences in filename without automatically modifying their order beforehand. Sequence are expected to be sorted by decreasing sequence length, unless *--usersort* is used.
+#'     In that case you may set `vsearch_args` to vsearch_args = "--strand both --usersort" 
+#' @param vsearch_args (default : "--strand both") a one length character element defining other parameters to
+#'   passed on to vsearch.
+#' @param keep_temporary_files (logical, default: FALSE) Do we keep temporary files ?
+#'   - temp.fasta (refseq in fasta or dna_seq sequences)
+#'   - cluster.fasta (centroid if method = "vsearch")
+#'   - temp.uc (clusters if method = "vsearch")
+#'
+#' @seealso [asv2otu()], [swarm_clustering()]
+#' @details This function use the [merge_taxa_vec()] function to
+#'   merge taxa into clusters. By default tax_adjust = 0. See the man page
+#'   of [merge_taxa_vec()].
+#'
+#' @return A new object of class `physeq` or a list of cluster if dna_seq
+#'   args was used.
+#'
+#' @references
+#'   VSEARCH can be downloaded from
+#'   \url{https://github.com/torognes/vsearch}.
+#'   More information in the associated publication
+#'   \url{https://pubmed.ncbi.nlm.nih.gov/27781170}.
+#' @export
+#' @author Adrien Taudière
+#'
+#' @examples
+#' 
+#' summary_plot_pq(data_fungi)
+#' d_vs <- vsearch_clustering(data_fungi)
+#' summary_plot_pq(d_vs)
+#' @details
+#' This function is mainly a wrapper of the work of others.
+#'   Please cite [vsearch](https://github.com/torognes/vsearch).
+vsearch_clustering <- function(physeq = NULL,
+                               dna_seq = NULL,
+                               nproc = 1,
+                               id = 0.97,
+                               vsearchpath = "vsearch",
+                               tax_adjust = 0,
+                               vsearch_cluster_method = "--cluster_size",
+                               vsearch_args = "--strand both",
+                               keep_temporary_files = FALSE) {
+  dna <- physeq_or_string_to_dna(physeq = physeq, dna_seq = dna_seq)
+
+  Biostrings::writeXStringSet(dna, paste0(tempdir(), "/", "temp.fasta"))
+
+  system2(
+    vsearchpath,
+    paste0(
+      paste0(
+        " ",
+        vsearch_cluster_method,
+        " ",
+        paste0(tempdir(), "/", "temp.fasta"),
+        " ",
+        vsearch_args
+      ),
+      " -id ",
+      id,
+      " --centroids ",
+      paste0(tempdir(), "/", "cluster.fasta"),
+      " --uc ",
+      paste0(tempdir(), "/", "temp.uc")
+    ),
+    stdout = TRUE,
+    stderr = TRUE
+  )
+
+  pack_clusts <-
+    utils::read.table(paste0(tempdir(), "/", "temp.uc"), sep = "\t")
+  colnames(pack_clusts) <-
+    c(
+      "type",
+      "cluster",
+      "width",
+      "identity",
+      "strand",
+      "6",
+      "7",
+      "cigarAlignment",
+      "query",
+      "target"
+    )
+
+  clusters <- pack_clusts$cluster[pack_clusts$type != "C"]
+  names(clusters) <- pack_clusts$query[pack_clusts$type != "C"]
+  clusters <- clusters[match(taxa_names(physeq), names(clusters))]
+
+  if (inherits(physeq, "phyloseq")) {
+    new_obj <-
+      merge_taxa_vec(physeq,
+        clusters,
+        tax_adjust = tax_adjust
+      )
+  } else if (inherits(dna_seq, "character")) {
+    new_obj <- pack_clusts
+  } else {
+    stop(
+      "You must set the args physeq (object of class phyloseq) or dna_seq (character vector)."
+    )
+  }
+
+  if (file.exists(paste0(tempdir(), "/", "temp.fasta")) &&
+    !keep_temporary_files) {
+    unlink(paste0(tempdir(), "/", "temp.fasta"))
+  }
+  if (file.exists(paste0(tempdir(), "/", "cluster.fasta")) &&
+    !keep_temporary_files) {
+    unlink(paste0(tempdir(), "/", "cluster.fasta"))
+  }
+  if (file.exists(paste0(tempdir(), "/", "temp.uc")) &&
+    !keep_temporary_files) {
+    unlink(paste0(tempdir(), "/", "temp.uc"))
+  }
+  return(new_obj)
+}
+###############################################################################
+
+
 ################################################################################
 #' Search for a list of sequence in an object to remove chimera taxa
 #'   using [vsearch](https://github.com/torognes/vsearch)
@@ -32,16 +506,17 @@
 #' @export
 #'
 #' @examples
-#' # data(data_fungi)
-#' data_fungi_nochim <- chimera_removal_vs(data_fungi)
-#' data_fungi_nochim_16 <- chimera_removal_vs(data_fungi,
-#'   abskew = 16,
-#'   min_seq_length = 10
-#' )
-#' data_fungi_nochim2 <-
-#'   chimera_removal_vs(data_fungi, type = "Select_only_non_chim")
-#' data_fungi_chimera <-
-#'   chimera_removal_vs(data_fungi, type = "Select_only_chim")
+#' \dontrun{
+#'   data_fungi_nochim <- chimera_removal_vs(data_fungi)
+#'   data_fungi_nochim_16 <- chimera_removal_vs(data_fungi,
+#'     abskew = 16,
+#'     min_seq_length = 10
+#'   )
+#'   data_fungi_nochim2 <-
+#'     chimera_removal_vs(data_fungi, type = "Select_only_non_chim")
+#'   data_fungi_chimera <-
+#'     chimera_removal_vs(data_fungi, type = "Select_only_chim")
+#' }
 #' @author Adrien Taudière
 #' @details
 #' This function is mainly a wrapper of the work of others.
@@ -154,11 +629,12 @@ chimera_removal_vs <-
 #' @export
 #'
 #' @examples
-#' # data(data_fungi)
-#' chimera_detection_vs(
-#'   seq2search = data_fungi@refseq,
-#'   nb_seq = taxa_sums(data_fungi)
-#' )
+#' \dontrun{
+#'   chimera_detection_vs(
+#'     seq2search = data_fungi@refseq,
+#'     nb_seq = taxa_sums(data_fungi)
+#'   )
+#' }
 #' @author Adrien Taudière
 #' @details
 #' This function is mainly a wrapper of the work of others.
diff --git a/man/add_funguild_info.Rd b/man/add_funguild_info.Rd
index 620985ad..3cf4242b 100644
--- a/man/add_funguild_info.Rd
+++ b/man/add_funguild_info.Rd
@@ -31,7 +31,7 @@ Please make a reference to \code{FUNGuildR} package and the associate
 use this function.
 }
 \examples{
-# data(data_fungi)
+
 df <- subset_taxa_pq(data_fungi, taxa_sums(data_fungi) > 5000)
 \dontrun{
 df <- add_funguild_info(df,
diff --git a/man/add_info_to_sam_data.Rd b/man/add_info_to_sam_data.Rd
index 94fcbe15..51264e99 100644
--- a/man/add_info_to_sam_data.Rd
+++ b/man/add_info_to_sam_data.Rd
@@ -34,7 +34,7 @@ Warning: The value nb_seq and nb_otu may be outdated if you transform your
 phyloseq object, e.g. using the \code{\link[=subset_taxa_pq]{subset_taxa_pq()}} function
 }
 \examples{
-# data(data_fungi)
+
 data_fungi <- add_info_to_sam_data(data_fungi)
 boxplot(data_fungi@sam_data$nb_otu ~ data_fungi@sam_data$Time)
 
diff --git a/man/are_modality_even_depth.Rd b/man/are_modality_even_depth.Rd
index 50b358cd..0e2ab7c1 100644
--- a/man/are_modality_even_depth.Rd
+++ b/man/are_modality_even_depth.Rd
@@ -29,7 +29,7 @@ This function apply a Kruskal-Wallis rank sum test to the number of sequences
 per samples in function of the factor \code{fact}.
 }
 \examples{
-# data(data_fungi)
+
 are_modality_even_depth(data_fungi, "Time")$p.value
 are_modality_even_depth(rarefy_even_depth(data_fungi), "Time")$p.value
 are_modality_even_depth(data_fungi, "Height", boxplot = TRUE)
diff --git a/man/biplot_pq.Rd b/man/biplot_pq.Rd
index 07026ee5..471f0eee 100644
--- a/man/biplot_pq.Rd
+++ b/man/biplot_pq.Rd
@@ -98,7 +98,7 @@ A plot
 \ifelse{html}{\href{https://lifecycle.r-lib.org/articles/stages.html#maturing}{\figure{lifecycle-maturing.svg}{options: alt='[Maturing]'}}}{\strong{[Maturing]}}
 }
 \examples{
-# data(data_fungi)
+
 data_fungi_2Height <- subset_samples(data_fungi, Height \%in\% c("Low", "High"))
 biplot_pq(data_fungi_2Height, "Height", merge_sample_by = "Height")
 }
diff --git a/man/blast_to_phyloseq.Rd b/man/blast_to_phyloseq.Rd
index 7bda4413..0755c137 100644
--- a/man/blast_to_phyloseq.Rd
+++ b/man/blast_to_phyloseq.Rd
@@ -79,7 +79,7 @@ the blast table
 }
 \examples{
 \dontrun{
-# data(data_fungi)
+
 blastpath <- "...YOUR_PATH_TO_BLAST..."
 blast_to_phyloseq(data_fungi,
   seq2search = system.file("extdata", "ex.fasta",
diff --git a/man/build_phytree_pq.Rd b/man/build_phytree_pq.Rd
index 711ee94f..bacbdb39 100644
--- a/man/build_phytree_pq.Rd
+++ b/man/build_phytree_pq.Rd
@@ -74,7 +74,7 @@ use this function.
 }
 \examples{
 library("phangorn")
-# data(data_fungi)
+
 df <- subset_taxa_pq(data_fungi, taxa_sums(data_fungi) > 9000)
 df_tree <- build_phytree_pq(df, nb_bootstrap = 5)
 plot(df_tree$UPGMA)
diff --git a/man/chimera_detection_vs.Rd b/man/chimera_detection_vs.Rd
index e8266c22..51b13464 100644
--- a/man/chimera_detection_vs.Rd
+++ b/man/chimera_detection_vs.Rd
@@ -57,7 +57,7 @@ This function is mainly a wrapper of the work of others.
 Please make \href{https://github.com/torognes/vsearch}{vsearch}.
 }
 \examples{
-# data(data_fungi)
+
 chimera_detection_vs(
   seq2search = data_fungi@refseq,
   nb_seq = taxa_sums(data_fungi)
diff --git a/man/chimera_removal_vs.Rd b/man/chimera_removal_vs.Rd
index 87efc694..3fee960a 100644
--- a/man/chimera_removal_vs.Rd
+++ b/man/chimera_removal_vs.Rd
@@ -45,7 +45,7 @@ This function is mainly a wrapper of the work of others.
 Please make \href{https://github.com/torognes/vsearch}{vsearch}.
 }
 \examples{
-# data(data_fungi)
+
 data_fungi_nochim <- chimera_removal_vs(data_fungi)
 data_fungi_nochim_16 <- chimera_removal_vs(data_fungi,
   abskew = 16,
diff --git a/man/compare_pairs_pq.Rd b/man/compare_pairs_pq.Rd
index fafd7eac..64fa78bf 100644
--- a/man/compare_pairs_pq.Rd
+++ b/man/compare_pairs_pq.Rd
@@ -48,7 +48,7 @@ and diversity
 \ifelse{html}{\href{https://lifecycle.r-lib.org/articles/stages.html#experimental}{\figure{lifecycle-experimental.svg}{options: alt='[Experimental]'}}}{\strong{[Experimental]}} #'   For the moment refseq slot need to be not Null.
 }
 \examples{
-# data(data_fungi)
+
 data_fungi_low_high <- subset_samples(data_fungi, Height \%in\% c("Low", "High"))
 compare_pairs_pq(data_fungi_low_high, bifactor = "Height", merge_sample_by = "Height")
 compare_pairs_pq(data_fungi_low_high,
diff --git a/man/diff_fct_diff_class.Rd b/man/diff_fct_diff_class.Rd
index 028cf36e..aa1a13bb 100644
--- a/man/diff_fct_diff_class.Rd
+++ b/man/diff_fct_diff_class.Rd
@@ -41,7 +41,7 @@ a single value
 Mainly an internal function useful in "lapply(..., tapply)" methods
 }
 \examples{
-# data(data_fungi)
+
 diff_fct_diff_class(
   data_fungi@sam_data$Sample_id,
   numeric_fonction = sum,
diff --git a/man/ggvenn_pq.Rd b/man/ggvenn_pq.Rd
index ffeb4d56..a41e5fd1 100644
--- a/man/ggvenn_pq.Rd
+++ b/man/ggvenn_pq.Rd
@@ -66,7 +66,7 @@ and \code{+ scale_x_continuous(expand = expansion(mult = 0.5))}. See
 examples.
 }
 \examples{
-# data(data_fungi)
+
 ggvenn_pq(data_fungi, fact = "Height")
 ggvenn_pq(data_fungi, fact = "Height") +
   ggplot2::scale_fill_distiller(palette = "BuPu", direction = 1)
diff --git a/man/hill_pq.Rd b/man/hill_pq.Rd
index 68739cd4..c22202af 100644
--- a/man/hill_pq.Rd
+++ b/man/hill_pq.Rd
@@ -64,7 +64,7 @@ Note that this function use a sqrt of the read numbers in the linear
 model in order to correct for uneven sampling depth.
 }
 \examples{
-# data(data_fungi)
+
 p <- hill_pq(data_fungi, "Height")
 p_h1 <- p[[1]] + theme(legend.position = "none")
 p_h2 <- p[[2]] + theme(legend.position = "none")
diff --git a/man/multi_biplot_pq.Rd b/man/multi_biplot_pq.Rd
index fd5e550d..b7cd4319 100644
--- a/man/multi_biplot_pq.Rd
+++ b/man/multi_biplot_pq.Rd
@@ -32,7 +32,7 @@ This allow to plot all the possible \code{\link[=biplot_pq]{biplot_pq()}} combin
 using one factor.
 }
 \examples{
-# data(data_fungi)
+
 data_fungi_abun <- subset_taxa_pq(data_fungi, taxa_sums(data_fungi) > 10000)
 p <- multi_biplot_pq(data_fungi_abun, "Height")
 lapply(p, print)
diff --git a/man/physeq_or_string_to_dna.Rd b/man/physeq_or_string_to_dna.Rd
index 4948e3ae..2d5b3433 100644
--- a/man/physeq_or_string_to_dna.Rd
+++ b/man/physeq_or_string_to_dna.Rd
@@ -26,7 +26,7 @@ Internally used in \code{\link[=vsearch_clustering]{vsearch_clustering()}}, \cod
 \code{\link[=asv2otu]{asv2otu()}}.
 }
 \examples{
-# data(data_fungi)
+
 dna <- physeq_or_string_to_dna(data_fungi)
 dna
 
diff --git a/man/plot_guild_pq.Rd b/man/plot_guild_pq.Rd
index 16cfc6df..ca7aacaa 100644
--- a/man/plot_guild_pq.Rd
+++ b/man/plot_guild_pq.Rd
@@ -28,7 +28,7 @@ A ggplot2 object
 }
 \examples{
 \dontrun{
-# data(data_fungi)
+
 df <- subset_taxa_pq(data_fungi, taxa_sums(data_fungi) > 5000)
 df <- add_funguild_info(df,
   taxLevels = c(
diff --git a/man/plot_mt.Rd b/man/plot_mt.Rd
index f60423df..7aba0316 100644
--- a/man/plot_mt.Rd
+++ b/man/plot_mt.Rd
@@ -22,7 +22,7 @@ a \code{\link{ggplot}}2 plot of result of a mt test
 \ifelse{html}{\href{https://lifecycle.r-lib.org/articles/stages.html#maturing}{\figure{lifecycle-maturing.svg}{options: alt='[Maturing]'}}}{\strong{[Maturing]}}
 }
 \examples{
-# data(data_fungi)
+
 # Filter samples that don't have Enterotype
 data_fungi <- subset_samples(data_fungi, !is.na(Time))
 res <- mt(data_fungi, "Time", method = "fdr", test = "f", B = 300)
diff --git a/man/rename_samples_otu_table.Rd b/man/rename_samples_otu_table.Rd
index ea64e185..10cb99e4 100644
--- a/man/rename_samples_otu_table.Rd
+++ b/man/rename_samples_otu_table.Rd
@@ -19,7 +19,7 @@ the matrix with new colnames (or rownames if \code{taxa_are_rows} is true)
 \ifelse{html}{\href{https://lifecycle.r-lib.org/articles/stages.html#experimental}{\figure{lifecycle-experimental.svg}{options: alt='[Experimental]'}}}{\strong{[Experimental]}}
 }
 \examples{
-# data(data_fungi)
+
 rename_samples_otu_table(data_fungi, as.character(seq_along(sample_names(data_fungi))))
 
 }
diff --git a/man/reorder_taxa_pq.Rd b/man/reorder_taxa_pq.Rd
index 67c160a5..bf0992d4 100644
--- a/man/reorder_taxa_pq.Rd
+++ b/man/reorder_taxa_pq.Rd
@@ -26,7 +26,7 @@ Note that the taxa order in a physeq object with a tree is locked by
 the order of leaf in the phylogenetic tree.
 }
 \examples{
-# data(data_fungi)
+
 data_fungi_ordered_by_genus <- reorder_taxa_pq(
   data_fungi,
   taxa_names(data_fungi)[order(as.vector(data_fungi@tax_table[, "Genus"]))]
diff --git a/man/ridges_pq.Rd b/man/ridges_pq.Rd
index 83818aff..334f6eda 100644
--- a/man/ridges_pq.Rd
+++ b/man/ridges_pq.Rd
@@ -31,8 +31,7 @@ taxonomic groups
 \ifelse{html}{\href{https://lifecycle.r-lib.org/articles/stages.html#experimental}{\figure{lifecycle-experimental.svg}{options: alt='[Experimental]'}}}{\strong{[Experimental]}}
 }
 \examples{
-data(data_fungi)
-data(data_fungi_sp_known)
+
 ridges_pq(data_fungi, "Time", alpha = 0.5, log10trans = FALSE) + xlim(c(0, 1000))
 ridges_pq(data_fungi, "Time", alpha = 0.5)
 ridges_pq(
diff --git a/man/save_pq.Rd b/man/save_pq.Rd
index 6f1ffbd0..185caa90 100644
--- a/man/save_pq.Rd
+++ b/man/save_pq.Rd
@@ -34,7 +34,7 @@ Write :
 }
 \examples{
 \dontrun{
-# data(data_fungi)
+
 save_pq(data_fungi, path = "phyloseq")
 }
 }
diff --git a/man/select_one_sample.Rd b/man/select_one_sample.Rd
index c433dbf4..783771d6 100644
--- a/man/select_one_sample.Rd
+++ b/man/select_one_sample.Rd
@@ -23,7 +23,7 @@ a physeq object with one sample
 Mostly for internal used, for example in function \code{\link[=track_wkflow_samples]{track_wkflow_samples()}}.
 }
 \examples{
-# data(data_fungi)
+
 A8_005 <- select_one_sample(data_fungi, "A8-005_S4_MERGED.fastq.gz")
 A8_005
 }
diff --git a/man/subset_samples_pq.Rd b/man/subset_samples_pq.Rd
index ed7a0961..3c7acc35 100644
--- a/man/subset_samples_pq.Rd
+++ b/man/subset_samples_pq.Rd
@@ -33,7 +33,7 @@ This function is robust when you use the sam_data slot of the phyloseq object
 used in physeq (see examples)
 }
 \examples{
-# data(data_fungi)
+
 cond_samp <- grepl("A1", data_fungi@sam_data[["Sample_names"]])
 subset_samples_pq(data_fungi, cond_samp)
 
diff --git a/man/subset_taxa_pq.Rd b/man/subset_taxa_pq.Rd
index 64ef0481..237a27c2 100644
--- a/man/subset_taxa_pq.Rd
+++ b/man/subset_taxa_pq.Rd
@@ -43,7 +43,7 @@ The main objective of this function is to complete the
 subset_taxa using a named boolean vector. Names must match taxa_names.
 }
 \examples{
-# data(data_fungi)
+
 subset_taxa_pq(data_fungi, data_fungi@tax_table[, "Phylum"] == "Ascomycota")
 
 cond_taxa <- grepl("Endophyte", data_fungi@tax_table[, "Guild"])
diff --git a/man/subset_taxa_tax_control.Rd b/man/subset_taxa_tax_control.Rd
index 417a84ae..3d1e105d 100644
--- a/man/subset_taxa_tax_control.Rd
+++ b/man/subset_taxa_tax_control.Rd
@@ -41,7 +41,7 @@ A new \code{\link{phyloseq-class}} object.
 \ifelse{html}{\href{https://lifecycle.r-lib.org/articles/stages.html#experimental}{\figure{lifecycle-experimental.svg}{options: alt='[Experimental]'}}}{\strong{[Experimental]}}
 }
 \examples{
-# data(data_fungi)
+
 
 subset_taxa_tax_control(data_fungi,
   as.numeric(data_fungi@otu_table[, 300]),
diff --git a/man/summary_plot_pq.Rd b/man/summary_plot_pq.Rd
index b1996c5e..41c08302 100644
--- a/man/summary_plot_pq.Rd
+++ b/man/summary_plot_pq.Rd
@@ -32,7 +32,7 @@ A ggplot2 object
 \ifelse{html}{\href{https://lifecycle.r-lib.org/articles/stages.html#maturing}{\figure{lifecycle-maturing.svg}{options: alt='[Maturing]'}}}{\strong{[Maturing]}}
 }
 \examples{
-# data(data_fungi)
+
 summary_plot_pq(data_fungi)
 summary_plot_pq(data_fungi, add_info = FALSE) + scale_fill_viridis_d()
 }
diff --git a/man/swarm_clustering.Rd b/man/swarm_clustering.Rd
index 76411de3..d15d06d5 100644
--- a/man/swarm_clustering.Rd
+++ b/man/swarm_clustering.Rd
@@ -71,7 +71,7 @@ Please cite \href{https://github.com/torognes/swarm}{SWARM}.
 }
 \examples{
 \dontrun{
-# data(data_fungi)
+
 summary_plot_pq(data_fungi)
 # Change with your PATH
 path_to_swarm <- "/home/adrien/miniconda3/bin/swarm"
diff --git a/man/tax_bar_pq.Rd b/man/tax_bar_pq.Rd
index acc435bb..ab2a4165 100644
--- a/man/tax_bar_pq.Rd
+++ b/man/tax_bar_pq.Rd
@@ -37,7 +37,7 @@ taxonomic groups
 \ifelse{html}{\href{https://lifecycle.r-lib.org/articles/stages.html#experimental}{\figure{lifecycle-experimental.svg}{options: alt='[Experimental]'}}}{\strong{[Experimental]}}
 }
 \examples{
-# data(data_fungi)
+
 data_fungi_ab <- subset_taxa_pq(data_fungi, taxa_sums(data_fungi) > 10000)
 tax_bar_pq(data_fungi_ab) + theme(legend.position = "none")
 tax_bar_pq(data_fungi_ab, taxa = "Class")
diff --git a/man/track_wkflow_samples.Rd b/man/track_wkflow_samples.Rd
index 6c7ee88b..41b984d2 100644
--- a/man/track_wkflow_samples.Rd
+++ b/man/track_wkflow_samples.Rd
@@ -23,7 +23,7 @@ Contrary to \code{\link[=track_wkflow]{track_wkflow()}}, only phyloseq object ar
 More information are available in the manual of the function \code{\link[=track_wkflow]{track_wkflow()}}
 }
 \examples{
-# data(data_fungi)
+
 tree_A10_005 <- subset_samples(data_fungi, Tree_name == "A10-005")
 track_wkflow_samples(tree_A10_005)
 }
diff --git a/man/tsne_pq.Rd b/man/tsne_pq.Rd
index 21e5b6a2..9196cc99 100644
--- a/man/tsne_pq.Rd
+++ b/man/tsne_pq.Rd
@@ -28,6 +28,6 @@ See ?Rtsne::Rtsne() for more information
 Compute tSNE position of samples from a phyloseq object
 }
 \examples{
-# data(data_fungi)
+
 res_tsne <- tsne_pq(data_fungi)
 }
diff --git a/man/upset_pq.Rd b/man/upset_pq.Rd
index 726a8c8d..d1417464 100644
--- a/man/upset_pq.Rd
+++ b/man/upset_pq.Rd
@@ -50,7 +50,7 @@ A \code{\link{ggplot}}2 plot
 Alternative to venn plot.
 }
 \examples{
-# data(data_fungi)
+
 upset_pq(data_fungi, fact = "Height", width_ratio = 0.2)
 upset_pq(data_fungi,
   fact = "Height", width_ratio = 0.2,
diff --git a/man/vs_search_global.Rd b/man/vs_search_global.Rd
index 30075929..bdbbc900 100644
--- a/man/vs_search_global.Rd
+++ b/man/vs_search_global.Rd
@@ -55,7 +55,7 @@ seqinr::write.fasta("GCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTTCA
   ACCCTCAAGCCCCTTATTGCTTGGTGTTGGGAGTTTAGCTGGCTTTATAGCGGTTAACTCCCTAAATATACTGGCG",
   file = file_dna, names = "seq1"
 )
-# data(data_fungi)
+
 res <- vs_search_global(data_fungi, file_dna)
 unlink(file_dna)
 
diff --git a/man/vsearch_clustering.Rd b/man/vsearch_clustering.Rd
index 8f66b4d7..aa9537c6 100644
--- a/man/vsearch_clustering.Rd
+++ b/man/vsearch_clustering.Rd
@@ -71,7 +71,7 @@ This function is mainly a wrapper of the work of others.
 Please cite \href{https://github.com/torognes/vsearch}{vsearch}.
 }
 \examples{
-# data(data_fungi)
+
 summary_plot_pq(data_fungi)
 d_vs <- vsearch_clustering(data_fungi)
 summary_plot_pq(d_vs)
diff --git a/man/write_pq.Rd b/man/write_pq.Rd
index 64304288..436e0252 100644
--- a/man/write_pq.Rd
+++ b/man/write_pq.Rd
@@ -84,7 +84,7 @@ and if present a phy_tree in Newick format
 \ifelse{html}{\href{https://lifecycle.r-lib.org/articles/stages.html#maturing}{\figure{lifecycle-maturing.svg}{options: alt='[Maturing]'}}}{\strong{[Maturing]}}
 }
 \examples{
-# data(data_fungi)
+
 # write_pq(data_fungi, path = "phyloseq")
 # write_pq(data_fungi, path = "phyloseq", one_file = TRUE)
 }
diff --git a/tests/testthat/test_cutadapt.R b/tests/testthat/test_cutadapt.R
new file mode 100644
index 00000000..e995227e
--- /dev/null
+++ b/tests/testthat/test_cutadapt.R
@@ -0,0 +1,62 @@
+suppressWarnings(swarm_error_or_not <-
+  try(system("cutadapt 2>&1", intern = TRUE), silent = TRUE))
+
+if (class(swarm_error_or_not) == "try-error") {
+  message(
+    "cutadapt_remove_primers()  can't be
+    tested when cutadapt is not installed"
+  )
+} else {
+  test_that("cutadapt_remove_primers works fine", {
+    expect_silent(suppressMessages(
+      res_cut <- cutadapt_remove_primers("inst/extdata", "TTC", "GAA",
+      folder_output = paste0(tempdir(), "/output_cutadapt")
+    )))
+    expect_type(res_cut, "list")
+    expect_equal(length(res_cut), 1)
+    expect_type(res_cut[[1]], "character")
+
+    expect_equal(length(list.files(paste0(tempdir(), "/output_cutadapt"))), 2)
+
+    expect_silent(
+      suppressMessages(res_cut2 <- cutadapt_remove_primers(
+        system.file("extdata",
+                    package = "dada2"
+        ),
+        pattern_R1 = "F.fastq.gz",
+        pattern_R2 = "R.fastq.gz",
+        primer_fw = "TTC",
+        primer_rev = "GAA",
+        folder_output = tempdir()
+      ))
+    )
+
+    expect_type(res_cut2, "list")
+    expect_equal(length(res_cut2), 2)
+
+    expect_type(res_cut2[[1]], "character")
+
+    expect_equal(length(list.files(paste0(tempdir(), "/output_cutadapt"))), 2)
+
+    expect_silent(
+      suppressMessages(res_cut3 <- cutadapt_remove_primers(
+        system.file("extdata",
+                    package = "dada2"
+        ),
+        pattern_R1 = "F.fastq.gz",
+        primer_fw = "TTC",
+        folder_output = tempdir(),
+        cmd_is_run = FALSE
+      )
+    ))
+
+    expect_type(res_cut3, "list")
+    expect_equal(length(res_cut3), 2)
+    expect_type(res_cut3[[1]], "character")
+
+    expect_equal(length(list.files(paste0(tempdir(), "/output_cutadapt"))), 2)
+  })
+
+  unlink(tempdir(), recursive = TRUE)
+
+}
diff --git a/tests/testthat/test_figures_alpha_div.R b/tests/testthat/test_figures_alpha_div.R
index 0cbc4ced..52ecadbf 100644
--- a/tests/testthat/test_figures_alpha_div.R
+++ b/tests/testthat/test_figures_alpha_div.R
@@ -70,7 +70,7 @@ test_that("hill_pq works with GP dataset", {
 test_that("iNEXT_pq works with data_fungi dataset", {
   library("iNEXT")
   expect_s3_class(
-    res_iNEXT <- iNEXT_pq(
+    suppressWarnings(res_iNEXT <- iNEXT_pq(
       data_fungi_sp_known,
       merge_sample_by = "Height",
       q = 1,
@@ -78,7 +78,7 @@ test_that("iNEXT_pq works with data_fungi dataset", {
       nboot = 5
     ),
     "iNEXT"
-  )
+  ))
   expect_s3_class(ggiNEXT(res_iNEXT), "ggplot")
   expect_s3_class(ggiNEXT(res_iNEXT, type = 2), "ggplot")
   expect_s3_class(ggiNEXT(res_iNEXT, type = 3), "ggplot")
diff --git a/tests/testthat/test_figures_beta_div.R b/tests/testthat/test_figures_beta_div.R
index 5d30396f..7000b8a4 100644
--- a/tests/testthat/test_figures_beta_div.R
+++ b/tests/testthat/test_figures_beta_div.R
@@ -378,3 +378,32 @@ test_that("multipatt_pq works with data_fungi dataset", {
   )
   expect_error(multipatt_pq(data_fungi, fact = "Time"))
 })
+
+test_that("multipatt_pq works with data_fungi dataset", {
+  expect_type(suppressMessages(suppressWarnings(res_height <- ancombc_pq(
+    subset_taxa_pq(
+      data_fungi_sp_known,
+      taxa_sums(data_fungi_sp_known) > 5000
+    ),
+    fact = "Height",
+    levels_fact = c("Low", "High"),
+    verbose = TRUE
+  ))), "list")
+
+  expect_s3_class(res_height$bias_correct_log_table, "data.frame")
+  expect_equal(dim(res_height$res), c(6, 15))
+
+  expect_type(suppressMessages(suppressWarnings(res_time <- ancombc_pq(
+    subset_taxa_pq(
+      data_fungi_sp_known,
+      taxa_sums(data_fungi_sp_known) > 5000
+    ),
+    fact = "Time",
+    levels_fact = c("0", "15"),
+    tax_level = "Family",
+    verbose = TRUE
+  ))), "list")
+
+  expect_s3_class(res_time$ss_tab, "data.frame")
+  expect_equal(dim(res_time$res), c(12, 15))
+})
diff --git a/tests/testthat/test_phyloseq_class.R b/tests/testthat/test_phyloseq_class.R
index e6f87eb7..e7547b6b 100644
--- a/tests/testthat/test_phyloseq_class.R
+++ b/tests/testthat/test_phyloseq_class.R
@@ -8,13 +8,15 @@ sequences_ex <- c(
 )
 test_that("asv2otu works fine with Clusterize method", {
   expect_s4_class(data_fungi_sp_known, "phyloseq")
-  expect_s4_class(asv2otu(data_fungi_sp_known), "phyloseq")
+  expect_s4_class(suppressWarnings(asv2otu(data_fungi_sp_known)), "phyloseq")
+  expect_s4_class(suppressWarnings(asv2otu(data_fungi_sp_known,
+                                           method = "longest")), "phyloseq")
 
   expect_error(asv2otu(enterotype, dna_seq = sequences_ex))
   expect_error(asv2otu(enterotype, method = "vsearch"))
   expect_error(asv2otu(enterotype))
   expect_error(asv2otu())
-  expect_error(asv2otu(method = "VsaerCh"))
+  expect_error(asv2otu(data_fungi_sp_known, method = "VsaerCh"))
   expect_error(asv2otu(data_fungi_sp_known, dna_seq = sequences_ex))
 })
 
diff --git a/tests/testthat/test_swarm.R b/tests/testthat/test_swarm.R
new file mode 100644
index 00000000..d4d2980b
--- /dev/null
+++ b/tests/testthat/test_swarm.R
@@ -0,0 +1,50 @@
+suppressWarnings(swarm_error_or_not <-
+                   try(system("swarm -h 2>&1", intern = TRUE), silent = TRUE))
+
+if (class(swarm_error_or_not) == "try-error") {
+  message(
+    "swarm_clustering() and asv2otu(..., method=swarm) can't be
+    tested when swarm is not installed"
+  )
+} else {
+
+  sequences_ex <- c(
+    "TACCTATGTTGCCTTGGCGGCTAAACCTACCCGGGATTTGATGGGGCGAATTAATAACGAATTCATTGAATCA",
+    "TACCTATGTTGCCTTGGCGGCTAAACCTACCCGGGATTTGATGGGGCGAATTACCTGGTAAGGCCCACTT",
+    "TACCTATGTTGCCTTGGCGGCTAAACCTACCCGGGATTTGATGGGGCGAATTACCTGGTAGAGGTG",
+    "TACCTATGTTGCCTTGGCGGCTAAACCTACC",
+    "CGGGATTTGATGGCGAATTACCTGGTATTTTAGCCCACTTACCCGGTACCATGAGGTG",
+    "GCGGCTAAACCTACCCGGGATTTGATGGCGAATTACCTGG",
+    "GCGGCTAAACCTACCCGGGATTTGATGGCGAATTACAAAG",
+    "GCGGCTAAACCTACCCGGGATTTGATGGCGAATTACAAAG",
+    "GCGGCTAAACCTACCCGGGATTTGATGGCGAATTACAAAG"
+  )
+
+  test_that("swarm_clustering works fine with phyloseq object", {
+    expect_s4_class(data_fungi_swarm <- swarm_clustering(data_fungi), "phyloseq")
+    expect_equal(ntaxa(data_fungi_swarm), 1301)
+  })
+
+  test_that("swarm_clustering works fine with dna sequences vector", {
+    expect_s3_class(sequences_ex_swarm <- swarm_clustering(dna_seq = sequences_ex), "data.frame")
+    expect_equal(dim(sequences_ex_swarm), c(12, 10))
+  })
+
+  test_that("asv2otu works fine with swarm method", {
+    expect_s4_class(
+      d_swarm <-
+        asv2otu(data_fungi_sp_known, method = "swarm"),
+      "phyloseq"
+    )
+
+    expect_equal(ntaxa(d_swarm), 600)
+    expect_true(nsamples(d_swarm) == nsamples(data_fungi_sp_known))
+
+     expect_s3_class(
+       seq_swarm <-
+      asv2otu(dna_seq = sequences_ex, method = "swarm"),
+      "data.frame"
+    )
+     expect_equal(dim(seq_swarm), c(12, 10))
+  })
+}
diff --git a/tests/testthat/test_targets.R b/tests/testthat/test_targets.R
index 27801f60..ba55bf37 100644
--- a/tests/testthat/test_targets.R
+++ b/tests/testthat/test_targets.R
@@ -151,6 +151,7 @@ test_that("subsample_fastq function works fine", {
 })
 
 test_that("sample_data_with_new_names function works fine", {
+   sam_file <- "inst/extdata/sam_data.csv"
    expect_silent(newdf <- sample_data_with_new_names(sam_file, paste0("Samples_", seq(1, 185))))
    expect_equal(dim(newdf)[1], 185)
    expect_equal(dim(newdf)[2], 7)
@@ -167,7 +168,7 @@ test_that("sample_data_with_new_names function works fine", {
     system.file("extdata", "sam2R.fastq.gz", package = "dada2")
   )
   expect_silent(filt_fastq_fw <- filter_trim(testFastqs_fw, output_fw = tempdir()))
-  expect_equal(length(derepFastq(filt_fastq_fw[1])), 4)
+  expect_equal(length(derepFastq(filt_fastq_fw[1])), 2)
   expect_silent(filt_fastq_pe <- filter_trim(testFastqs_fw,
     testFastqs_rev,
     output_fw = tempdir("fw"),
@@ -188,4 +189,4 @@ test_that("add_info_to_sam_data function works fine with data_fungi", {
   expect_equal(dim(data_fungi2@sam_data)[2], 11)
   expect_equal(length(data_fungi2@sam_data$nb_seq), 185)
   expect_equal(length(data_fungi2@sam_data$nb_otu), 185)
-})
\ No newline at end of file
+})
diff --git a/tests/testthat/test_vsearch.R b/tests/testthat/test_vsearch.R
index 07e1d8a1..7a863734 100644
--- a/tests/testthat/test_vsearch.R
+++ b/tests/testthat/test_vsearch.R
@@ -6,31 +6,125 @@ sequences_ex <- c(
 
 data("data_fungi")
 df_basidio <- subset_taxa(data_fungi, Phylum == "Basidiomycota")
-df_basidio <- subset_taxa_pq(df_basidio, colSums(df_basidio@otu_table) > 1000)
+df_basidio <-
+  subset_taxa_pq(df_basidio, colSums(df_basidio@otu_table) > 1000)
 # path_db <- "inst/extdata/100_sp_UNITE_sh_general_release_dynamic.fasta"
 
-suppressWarnings(vsearch_error_or_not <- try(system("vsearch 2>&1", intern = TRUE), silent = TRUE))
+suppressWarnings(vsearch_error_or_not <-
+                   try(system("vsearch 2>&1", intern = TRUE), silent = TRUE))
 
 if (class(vsearch_error_or_not) == "try-error") {
-  message("vs_search_global() and asv2otu(..., method=vsearch) can't be tested when vsearch is not installed")
+  message(
+    "vs_search_global() and asv2otu(..., method=vsearch) can't be tested when vsearch is not installed"
+  )
 } else {
   test_that("asv2otu works fine with vsearch method", {
-    expect_s4_class(d_vs <- asv2otu(data_fungi_sp_known, method = "vsearch"), "phyloseq")
-    expect_s4_class(d_fast <- asv2otu(data_fungi_sp_known,
-      method = "vsearch",
-      vsearch_cluster_method = "--cluster_fast"
-    ), "phyloseq")
-    expect_s3_class(asv2otu(dna_seq = sequences_ex, method = "vsearch"), "data.frame")
+    expect_s4_class(
+      d_vs <-
+        asv2otu(data_fungi_sp_known, method = "vsearch"),
+      "phyloseq"
+    )
+    expect_s4_class(
+      d_fast <- asv2otu(
+        data_fungi_sp_known,
+        method = "vsearch",
+        vsearch_cluster_method = "--cluster_fast"
+      ),
+      "phyloseq"
+    )
+    expect_s3_class(
+      asv2otu(dna_seq = sequences_ex, method = "vsearch"),
+      "data.frame"
+    )
     expect_true(sum(!d_fast@refseq == d_vs@refseq) > 0)
     expect_equal(sum(dim(d_vs@otu_table) == dim(d_fast@otu_table)), 2)
   })
 
   test_that("vs_search_global works fine with vsearch method", {
-    expect_s3_class(res <- vs_search_global(data_fungi,
-      path_to_fasta = "inst/extdata/ex_little.fasta"
-    ), "data.frame")
+    expect_s3_class(
+      res <- vs_search_global(data_fungi,
+        path_to_fasta = "inst/extdata/ex_little.fasta"
+      ),
+      "data.frame"
+    )
     expect_equal(dim(res), c(1420, 10))
-    expect_s3_class(res <- vs_search_global(data_fungi, sequences_ex), "data.frame")
-    expect_s3_class(res <- vs_search_global(data_fungi, Biostrings::DNAStringSet(sequences_ex)), "data.frame")
+    expect_s3_class(
+      res <-
+        vs_search_global(data_fungi, sequences_ex),
+      "data.frame"
+    )
+    expect_s3_class(
+      res <-
+        vs_search_global(data_fungi, Biostrings::DNAStringSet(sequences_ex)),
+      "data.frame"
+    )
+  })
+
+  test_that("chimera_detection_vs works fine", {
+    expect_type(
+      chimera_fungi <- chimera_detection_vs(
+        seq2search = data_fungi@refseq,
+        nb_seq = taxa_sums(data_fungi)
+      ),
+      "list"
+    )
+    expect_s4_class(chimera_fungi$non_chimera, "AAStringSet")
+
+    expect_equal(length(chimera_fungi$non_chimera), 1051)
+    expect_equal(length(chimera_fungi$chimera), 242)
+    expect_equal(length(chimera_fungi$borderline), 127)
+  })
+
+  test_that("chimera_detection_vs works fine", {
+    expect_s4_class(
+      data_fungi_nochim <-
+        chimera_removal_vs(data_fungi),
+      "phyloseq"
+    )
+    expect_equal(ntaxa(data_fungi_nochim), 1178)
+    expect_s4_class(
+      data_fungi_nochim_16 <- chimera_removal_vs(data_fungi,
+        abskew = 16,
+        min_seq_length = 10
+      ),
+      "phyloseq"
+    )
+    expect_equal(ntaxa(data_fungi_nochim_16), 1259)
+    expect_s4_class(
+      data_fungi_nochim2 <-
+        chimera_removal_vs(data_fungi, type = "Select_only_non_chim"),
+      "phyloseq"
+    )
+    expect_equal(ntaxa(data_fungi_nochim2), 1051)
+
+    expect_s4_class(
+      data_fungi_chimera <-
+        chimera_removal_vs(data_fungi, type = "Select_only_chim"),
+      "phyloseq"
+    )
+    expect_equal(ntaxa(data_fungi_chimera), 242)
+  })
+
+
+  test_that("vsearch_clustering works fine", {
+    expect_s4_class(d_vs1 <- vsearch_clustering(data_fungi), "phyloseq")
+    expect_equal(ntaxa(d_vs1), 701)
+
+    expect_s4_class(d_vs2 <- vsearch_clustering(data_fungi,
+      id = 0.98,
+      vsearch_cluster_method = "--cluster_size"
+    ), "phyloseq")
+    expect_equal(ntaxa(d_vs2), 817)
+
+    expect_s4_class(d_vs3 <- vsearch_clustering(data_fungi,
+                                               id = 0.98,
+                                               vsearch_cluster_method = "--cluster_smallmem",
+                                               vsearch_args = "--strand both --usersort"
+    ), "phyloseq")
+
+
+    expect_type(seq_clustered <- vsearch_clustering(dna_seq = sequences_ex),
+                "list")
+    expect_equal(dim(seq_clustered), c(4, 10))
   })
 }
diff --git a/vignettes/articles/essai_article.Rmd b/vignettes/articles/essai_article.Rmd
deleted file mode 100644
index 289a5796..00000000
--- a/vignettes/articles/essai_article.Rmd
+++ /dev/null
@@ -1,14 +0,0 @@
----
-title: "essai_article"
----
-
-```{r, include = FALSE}
-knitr::opts_chunk$set(
-  collapse = TRUE,
-  comment = "#>"
-)
-```
-
-```{r setup}
-library(MiscMetabar)
-```
diff --git a/vignettes/articles/explore_data.Rmd b/vignettes/articles/explore_data.Rmd
index f3e67083..82abc8dc 100644
--- a/vignettes/articles/explore_data.Rmd
+++ b/vignettes/articles/explore_data.Rmd
@@ -10,7 +10,8 @@ vignette: >
 ```{r, include = FALSE}
 knitr::opts_chunk$set(
   collapse = TRUE,
-  comment = "#>"
+  comment = "#>",
+  message = FALSE
 )
 ```
 
@@ -99,3 +100,9 @@ heatmap(fungi_order@otu_table)
 
 
 
+
+# Session information
+
+```{r}
+sessionInfo()
+```