-
Notifications
You must be signed in to change notification settings - Fork 156
New issue
Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.
By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.
Already on GitHub? Sign in to your account
Incorrect Annotation for Frameshift Variant in VEP 113 #1796
Comments
Hi @GSYongWu, |
Hi, |
Hi @GSYongWu, |
Hi, Ola I tried removing this parameter, and the issue with the reported mutation sites was indeed resolved. However, other sites were affected. For example, at the site 7:55248981_T>TCCAGGAAGC, the HGVSp should be p.A763_Y764insQEA, but after removing the --shift_3prime parameter, the HGVSp is empty. The consequence also changed from inframe_insertion to splice_region_variant. Best regards, |
Hi @GSYongWu, |
Hi @GSYongWu, |
Hi,
I would like to report an issue with the variant annotation in VEP version 113. Specifically, variants that should be annotated as
frameshift_variant
are being incorrectly annotated asinframe_insertion
.Example Variant:
Variant: 17:58740533_A>AAAGCCCTGACTTTAAGGATACATGATTC
Current VEP 113 Annotation:
inframe_insertion & stop_retained_variant
VEP 111 Annotation:
stop_gained & frameshift_variant
HGVSp Results:
It appears that the results from VEP 111 are correct.
Could you please investigate this discrepancy? Correct annotation of such variants is crucial for downstream analyses.
Thank you for your attention to this matter.
Best regards,
The text was updated successfully, but these errors were encountered: